Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig5523  (registered. 2012)
Contig Information
Length 616 bp
Clones alternative view 12 Clones [Download: TSV  ,  FASTA ]
Wh_h Spike at heading date 1
Wh_r Root 1
Wh_SHDr Shoot grown with dessication 2
Wh_VABA Shoot with ABA treatment 1
WH_XT Roots, 18 day old plants were grown hydroponically 2
WH_XC Root, treated at 50 microM Al for 6h 2
WH_XD Root, treated at 50 microM Al for 6h 3
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit (no hit)
Score
Evalue
Total Hit Count 0
Registered year 2012
Contig Sequence     [ Download ]
>Contig5523
TTTTTTTTTTGCTGAAAGAAGCGTGGCCAATATCTGAAGAATTCTTCAGGAGCTTCCTTTTTTTGCGACAAAGTCAAGAGCTTACATTACACGGCAGTAT
GCACTGTACTGACACCCGCACACACACGAACAGACACATGGATCAATCAATACTCAATAGTACATTTCATGTCGAGAAGCTAGTAGGAGAAAAGGGGATA
GCGATCACACCGAGCAAGAGCTGCAGACAAAATACACGATGACAGTATGAGACAGACGCAGCAACAACACTACTACTACGAGGCTACATGATACGCAACA
TCCGGCGAGGCGAGCTGGCTGGCTGGTTAACGGCAGACGATGCAAAGGATGATGGCGATGATCACCACCAGCGCCACGAGGGGCAGCGAGATTATCAGTA
CCATCTGCATCTTGCCGGCTGCTGGTGCTCTGACGCGCGACCTGAAGGCTGAAGCTGTGGCTCCTCCTGCTGCTCTGCTCAAGATATCTCTCCCAGCTGA
TGGCGAGAAGCTTAAGCACGAGGATGAGGCAGGCAGAGCGAAGCAAACGGAGGGGGTTAAATGGAGGGATTATGGAAGGGAGGGGAGGGGAGGGGCGGGG
AAAGCCAACCTCGTGC
page-top