Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig1782  (registered. 2003)
Contig Information
Length 305 bp
Clones 2 Clones [Download: TSV  ,  FASTA ]
Wh_HGCPCDAM Anther at meiosis of MT4B CS wheat 2
Homology (BLAST) Top Hit ribosomal protein L36 containing protein [Zea mays] (no hit)
Score 230
Evalue 7.06847e-18
Total Hit Count 0
Registered year 2003
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig1782
GCAATGGTCGATGTGGCCATTCAAAATCCTCTAATATGAAAAGAGGAGGTCAAGTAGTTTGAGGCGGCAATGGCCTATTTTGGTAGTTTTTCTATCCTCG
TGAGTATCCCTCTTGACTTGCCTGTGCTCGACTTGAATCGTTCTCCCTATTAGATGGGTGAACAAAAATTCATGTTATCTTGTTACATTGTCCTTTTTAC
CGAGTCATCCACATATCTGTCATCATTGAAACAAGAAAAGAAAGGTGTGTGGACGTCAGAAATGATCTAACTGAGAGCTTGTGAGCTCTGGAAGTAAAAA
AAAAA
page-top