Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig5514  (registered. 2012)
Contig Information
Length 856 bp
Clones alternative view 24 Clones [Download: TSV  ,  FASTA ]
Wh_RDr Root of dessiccated seed 2
Wh_SHDr Shoot grown with dessication 11
Wh_VSCB Liquid cultured tissue 1
WH_XI Two-week old seedlings(22℃ 16L-8D) 3
WH_XR Roots, 18 day old plants were grown hydroponically 1
WH_XS Roots, 18 day old plants were grown hydroponically (supplemented with 10 mM Boric Acid for 24 h) 2
WH_XU Roots, 18 day old plants were grown hydroponically (supplemented with 10 mM Boric Acid for 24 h) 3
WH_XA Root 1
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|7452981|emb|CAB86384.1|| allene oxide synthase [Hordeum vulgare subsp. vulgare]
Score 348
Evalue 6.00E-94
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig5514
TTTTTTTTTTACCGTACGCCAAGAGTGAGAATCTTATTACAGGAAAGTCCGGCTTATTACACTGGGCAAGATTGCGAAAAGTAAAACACACATACACAAG
GGCACCATGCAGGATGCAGCGATGCAGCGAAGCAACCGAACAAGATGCATGCATGACTGACTCGTACTAGTAGTATATAGCGAGGCACGTACGTACGTGC
GCGCTGACGGGGACGATTGATGGCTGCTGTGAGAGAGCTGCTGCGGTACGTTGATCCGATGACCGGTGCAGGTTCTAATTTTTAAACAGCGCTCTCAGGA
CCGGACGTGGCCTTGGTGACGCCGGTGAACTCAACCTTGGTGCCGAGCAGGTCGACCCCGACGTCGGCGGTGAAGGTGTCGTACCGGAGGAACAGCTCCA
CCACCAGGAGCCTGCCCACGAGCACGACCAGGTTCTTGCCTGGGCACTGCTTGTTGTCCACGCTGGGGCTCTCGGTCTCCCGCCCGTTGGACCAGTACAC
GTACTGCAGCAGCTTCCTTCCCTCCTCCCCGACGAACCGGTCGCCGACGAACTCCCTCGCCGTGGAGCCGAACACGCGGGGGTCCCTGGTGGCGCACGGC
TGGTACCCGAACAGCATCTCCCCCTTCTTCACGGCGAACACCGCGTCGTGGCTCTCGATGTTCATGTCCGCCTTGGCGCGGCCGTACTGGAACTTGACGG
GCGGGTCCAGCCGCAGCGCCTCCCACACCGCCGACTTGGTCAGCTCCATCTTCTCCAGCGCCTCTATCGTCACCTTGCCGCCGGCGTCCGCCACGGCGGC
GCGTATCTCCGCGACGAGCTTCTGGTGGAACTTCTCTCCGGCCCCCGCGATGCGCG
page-top