Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig1678  (registered. 2003)
Contig Information
Length 665 bp
Clones 2 Clones [Download: TSV  ,  FASTA ]
Wh_CSEC Callus 1
Wh_GCPCDAM Anther at meiosis of DT4B CS wheat 1
Homology (BLAST) Top Hit Os12g0502700 [Oryza sativa (japonica cultivar-group)] >gi|108862715|gb|ABA98642.2| DnaJ domain containing protein, expressed [Oryza sativa (japonica cultivar-group)] >gi|113649338|dbj|BAF29850.1| Os12g0502700 [Oryza sativa (japonica cultivar-group)]
Score 425
Evalue 3.5755e-40
Total Hit Count 100
Registered year 2003
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig1678
CAGCATGACCTGTTTCTTCCAAATGAGAAAACAACTTGCTCCTTGACTCAAAAGTATCTCCACATGTTTCACAATCATTGCTTGCCTTCGAAACCTCCTT
TTGCTTCTTTCCCTTTGATGTGAACTTTAGGTCAGCAGAAACAGTTGTTTTCTTCTCTGCGCCTTTCTTGTTCTTTTTGTTCTTTTTAGGATTGTCAGTC
TTTTCGTTCTGTTGGCTTCCAACGCTTGCTGATGTGCCGTCATCATTAGAAGTGGGTGGACCTTCCGCCTTATCATCAGCATCATTTTCATCATTATCAT
GCACAGATTCCTCATACGGAACATTATTCTTCATACCATGTCCACTATCAGCATAACTACCTTCATCTTGTCCCTTCTTTGATGCCCGCCTCCGGCGTCC
TTTCTTCTTGACACTCTTAACTTCAGAATTTCTATCTTCACTGTTATCATCCTCTGTAACAACAGAAGGAGCTTCCTCTTGAGGAACCACATAGCCACTT
TTCTTGTTCTTACGGCTTGACAACATCGCCTCCAACACACTTGTCTCATCATATGAACCAACCTCCTGCTCCCCATTATTGAAGTCCTTATTACCATTGT
CTTCATCCGCCACCTCCAAGCCCTCGTCCAACTCCTCACTAGTCTCGAGTTTTTTTTTTTTTTTT
page-top