Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig5509  (registered. 2012)
Contig Information
Length 1068 bp
Clones alternative view 13 Clones [Download: TSV  ,  FASTA ]
Wh_e Seed DPA10 1
Wh_CSEC Callus 2
Wh_SHDr Shoot grown with dessication 1
WH_XI Two-week old seedlings(22℃ 16L-8D) 4
WH_XO Leaves, seedling were infercted with blast strain Pr48 for 4 days (23℃ ) 2
WH_XR Roots, 18 day old plants were grown hydroponically 2
WH_XS Roots, 18 day old plants were grown hydroponically (supplemented with 10 mM Boric Acid for 24 h) 1
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|60100222|gb|AAX13280.1|| ethylene-responsive element binding protein 1 [Triticum aestivum]
Score 511
Evalue 6.00E-143
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig5509
TTTTTTTTTTACCAAACACTGGCTTCAAAGTTAAAAGGTTTACAGCCACTTGTAGCAATTACAATAAGGTAGAAACAGGAATACAAAATAAGCAGTTCCC
ATCACATACTGGTTTCATATATAGATATAATATAGTCTGGGGGCACAAGACAGAGGTCTATTGCAAAAGACTTAGGTCTCCTGACCATTTAAGCTAGACA
TAACCATAGACTGACGTCGCTACTGCTCGATTCTAGAGGCACCAGACACAAGCACTTGTTGATGTCCAGAATACTTATTCCTTTGTCTATATATACAGGC
ACCCAGCGACCTCGATTCCCTCAGTAGAAACCAGCAGACAAGGGCATGTCATCAAAGGTCCAAAGGCCCATGTTGCCGACAACGTCCTGCGGTACATCAC
AGCTTAGAATGCTGTCAATTGACTCATCTGAACCATCGTCCATCAGGAACTTCATGTATGGCTCCAAGTCGGCAAGATCAACATTAGCATCACCCATCAC
AGGAGGTACCGTTGAATTAATGCCATTGTTCTGGAGAAATGCAGATTCATTGACCTCAGTTGAGGTGGGAATGGATGCAAGCACAGAAGTTATGTCAGGG
GTCTTGATATCATTCTCCCAGCTGAAGTCTGAGCAACTAAAGGAGTTGCTCCCCTGGTCAGAGGAAAAATTCATGAAAGGAGCCTCAACTGCATTCACTG
TAGGCACAAACGACATGTTCTGAGGCTGCACAAATTGCTGATTTAAGGTGTAGTCAACAGCAGGGCAGGAATACACATCTGTGTTGCCCATGGTGTTGAG
TACTGGCTTCTGTTCGGTGTTGAACTCGGGCACCTTCACAGAGGTAGCGCAGCGTTGCTGAGGATCCATGGGAGCTTCTTCTGGGAAATTGACCTTTGCC
TTCTTGCCACGAATTCTGCGGGCTTCAACATCATAGGCTCTGGCAGCTTCCTCAGCAGAGTTGTAAGTGCCAAGCCAGACACGGACACCCTTGCGAGGAT
CTCTTATTTCAGCAGCCCATTTACCCCAAGGGCGGCGGCGGATGCCCCTGAACTGGCTCTTTCTCTTC
page-top