Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig5504  (registered. 2012)
Contig Information
Length 1774 bp
Clones alternative view 54 Clones [Download: TSV  ,  FASTA ]
Wh_SL Seed DPA30 1
Wh_e Seed DPA10 3
Wh_oh Pistil at heading date 1
Wh_DPA20 Seed DPA20 3
Wh_KMP Shoot grown under continuous light 1
Wh_MS Seed DPA5 of DT3DL CS wheat 3
Wh_OKCS Seed DPA5 2
Wh_RDr Root of dessiccated seed 1
Wh_SHDr Shoot grown with dessication 1
Wh_VHS Shoot with heat shock treatment 2
Wh_VSCB Liquid cultured tissue 11
WH_XL Roots, two-week old seedlings treated with 150-mM NaCl for 24h (22℃ 16L-8D) 4
WH_XQ Leaves, seedling were infercted with blast strain Pr58 for 4 days (27℃ ) 3
WH_XR Roots, 18 day old plants were grown hydroponically 2
WH_XS Roots, 18 day old plants were grown hydroponically (supplemented with 10 mM Boric Acid for 24 h) 1
WH_XT Roots, 18 day old plants were grown hydroponically 1
WH_XU Roots, 18 day old plants were grown hydroponically (supplemented with 10 mM Boric Acid for 24 h) 3
WH_XA Root 5
WH_XC Root, treated at 50 microM Al for 6h 2
WH_XD Root, treated at 50 microM Al for 6h 2
WH_XG Seedling, infected with powdery mildew (AvrPm3b) 2
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|1703227|sp|P52894.1|ALA2_HORVU|ALA2_HORVU RecName: Full=Alanine aminotransferase 2; Short=ALAAT-2; AltName:
Score 932
Evalue 0
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig5504
ACATCGCCTTCCTTTCTCCCTTCCGAGTCGCCACAAAACCGAGGAAAGAGAGAGACGGACAGGATATACTCGCTGCTCTGCCGCCCCCTTCGCCTTTAGT
TGATCTCGCCATGGCTGCCACCGTCGCCGTGGACAACCTGAACCCCAAGGTTTTAAAATGTGAGTATGCTGTGCGTGGAGAGATTGTCATCCATGCTCAG
CGCTTGCAGCAACAGCTGCAAACTCAACCAGGATCTCTACCTTTTGATGAGATCCTCTATTGTAACATTGGGAACCCACAATCTCTTGGTCAGCAACCAG
TTACATTCTTCAGGGAGGTTCTTGCACTTTGTGATCATCCAGACCTGTTGAAAAAGGAGGAAATCAAAACATTGTTCAGTGCTGATTCTATTTCTCGAGC
AAAGCAGATTCTTGCCTTGATACCTGGAAGAGCAACAGGAGCATACAGTCATAGCCAGGGTATAAAAGGACTTCGTGATGCAATTGCTTCTGGGATCGCT
TCACGAGATGGATTCCCTGCTAATGCTGATGACATTTTTCTTACAGATGGAGCAAGCCCTGGGGTGCACCTGATGATGCAATTACTGATAAGGAATGAGA
AAGATGGCATTCTTGTCCCGATTCCTCAGTACCCTTTGTACTCGGCTTCTATAGCTCTTCATGGCGGATCTCTTGTCCCATACTATCTCAATGAATCGAC
GGGCTGGGGTTTGGAAATCTCTGATGTTAAGAAGCAACTCGAAGATGCTCGCTCAAGAGGCATCGACGTTAGGGCTTTGGTGGTTATCAATCCAGGAAAT
CCTACTGGACAGGTACTTGCTGAGGAAAACCAATATGACATAGTGAAGTTCTGCAAAAATGAGGGTCTTGTTCTTCTGGCTGATGAGGTATACCAAGAGA
ACATCTACGCTGACAACAAGAAATTCCACTCTTTCAAGAAGATAGTGAGATCCTTGGGATACGGCGAGGATGATCTCCCTCTAGTATCATATCAATCTGT
TTCTAAGGGATATTATGGTGAGTGTGGTAAAAGAGGTGGTTACATGGAGATTACTGGCTTCAGTGCTCCAGTAAGAGAGCAGATCTACAAAATAGCATCA
GTGAACCTATGTTCCAATATCACCGGCCAGATCCTTGCTAGTCTTGTCATGAACCCACCAAAGGCTAGTGATGAATCATATGCTTCATACAAGGCAGAAA
AGGATGGGATCCTTGCATCGTTAGCTCGTCGTGCGAAGGCATTGGAGATTGCATTCAGTAAACTTGAGGGAATTACTTGCAACAAGGCTGAAGGAGCAAT
GTACCTGTTCCCTCAAATCTGTCTGCCACAGAAGGCGATTGAGGCTGCTAAAGCTGCTAACAAGGCACCTGATGCATTCTATGCTCTTCGTCTCCTTGAG
TCGACCGGAATCGTCGTTGTCCCTGGATCTGGATTTGGCCAGGTTCCTGGCACATGGCACTTCAGGTGCACGATCCTTCCGCAGGAGGAGAAGATCCCGG
CGATCATCTCCCGCTTCACGGTGTTCCATGAGACGTTCATGGCAGAGTACCGTGACTAAACTGGTGTAACATGTGTGGGATTACATGCAAGCCTCGTGGA
TTTTCCCTAGGCGTTTTTGCCCCCGTTGACAGCAGTATCATGTAGACGAGACAAAATAAAGCAAATCCATGGCTTGTGTGTGTGATATACTATATCAGAT
TCTGAAACAGATTACCAGTCTGATGCGTTTGATGGTAAATTGGCAACTGAGATCTTTTTCCCCCAAAAAAAAAA
page-top