Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig5500  (registered. 2012)
Contig Information
Length 756 bp
Clones alternative view 48 Clones [Download: TSV  ,  FASTA ]
Wh_SL Seed DPA30 2
Wh_yd Spikelet at late flowering 2
Wh_EMI Dormant seed with water absorption after breaking 13
Wh_RDr Root of dessiccated seed 5
Wh_SHDr Shoot grown with dessication 2
WH_XJ Roots, two-week old seedlings treated with 150-mM NaCl for 6h (22 16L-8D) 3
WH_XL Roots, two-week old seedlings treated with 150-mM NaCl for 24h (22 16L-8D) 9
WH_XO Leaves, seedling were infercted with blast strain Pr48 for 4 days (23 ) 6
WH_XP Leaves, seedling were infercted with blast strain Pr58 for 4 days (23 ) 2
WH_SP 2
WH_XX Leaves, seedling were infercted with blast strain Pr58 for 4 days (23 ) 2
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|62738051|pdb|1TX6|I|I Chain I, Trypsin:bbi Complex"
Score 258
Evalue 6.00E-67
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig5500
TTTTTTTTTTGAAGCGGAAGAAAACAGCACCGTTCGTTTATATAAAGATAAAGATTGAACATTGCCACGTTGTCTTATTCATAATTGTGTGTCCACCACA
CATATAGGCCATCCATTTCTATTTTATTCTTAGACACTGCTGCTGCAGCAGGGCGGGAGAGGACACTCGACGGCGTTGATCGGGTGATCAACGCGTGAGC
GTGCTAGTTACCGCCGGCGGCAACAGCCTCTGACGGCGTGCACGCGGGCGGGAAGGGTCCAAAGTAGCGGTCGATGCAGACGCGGAGAGAAGGGCGCGAC
CTGGACGGCAGGCAGGTCTTGCAGGTCGGAGCACACTTGTCGACCTCGTCCATGCATTGGCACGTCGGCGGGTTGGACCTGGTGCACAGGGGCAGGTCGC
AGCAGTCCCAGGGCCTGCAGATGGGCCCGGGGTCGCCGACGTACTGGTCTTGGCAGACGCGGCGGGACGGGTCGCCCACGGACGGCCCGCAGGCCTTGCA
GGTGGAGGGGCACTCGAAGACCTGGTCCATGCAGCGGCAGATCGGCGGGATGGACCTGGTGCACACCGCCTGGTCGCAGCACTTCCACGGCCTCTTCTTG
GCCGCCATGGCTGCTTCGTCTTGGCCTTGGCTCGGCAGGAGAATGGCATCCACGTCGCCGGCGACGAGGAGGGCTGCCTGCAGTGCAAGCATCAGCAGGA
TGCTAGGAACGACGCATCGCTTCATTCCCATGGCGTGCTTACTGAGCTTGCCCTCG
page-top