Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig1507  (registered. 2003)
Contig Information
Length 341 bp
Clones 2 Clones [Download: TSV  ,  FASTA ]
Wh_V483 Shoot grown under cold condition for 3days 2
Homology (BLAST) Top Hit hypothetical protein [Paramecium tetraurelia strain d4-2] >gi|74834160|emb|CAI44466.1| Tyrosyl-DNA phosphodiesterase [Paramecium tetraurelia] >gi|124417026|emb|CAK82041.1| unnamed protein product [Paramecium tetraurelia]
Score 74
Evalue 7.75661
Total Hit Count 1
Registered year 2003
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig1507
CTATTTCACAGAGGATGATATATAGTACCATAGATAAGCATAGATTGTTTAGTCATGAACCAAAGACATCCTCCTGCAACAAGCGCTTAACCTGAGAGCA
CTAAAAAACTACCTCTACGGCTCTACCAACCAAGCAAGTTCTACAAAGAAATTAACTCGGAAGCCGGCGGCTATAATCATGTAAACCACCCGCACATCAG
CATGATAGTTTTGACTTTTGATCCAACTATCAACGACAGAATCCAACTTGGAAGAGTACATTTCTCCAGAGGGCAAAAAAAAAAAANATNCCCTTTNNGA
TAANGCTCNGGGCCTTCAGCNNGCCNTCANTCAAAACNCCT
page-top