Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig5483  (registered. 2012)
Contig Information
Length 1511 bp
Clones alternative view 19 Clones [Download: TSV  ,  FASTA ]
Wh_oh Pistil at heading date 2
Wh_yd Spikelet at late flowering 2
Wh_DPA20 Seed DPA20 1
Wh_MS Seed DPA5 of DT3DL CS wheat 2
Wh_SHDr Shoot grown with dessication 4
WH_XS Roots, 18 day old plants were grown hydroponically (supplemented with 10 mM Boric Acid for 24 h) 1
WH_XT Roots, 18 day old plants were grown hydroponically 1
WH_XA Root 2
WH_XC Root, treated at 50 microM Al for 6h 2
WH_XD Root, treated at 50 microM Al for 6h 1
WH_XF Seedling, infected with leaf rust 1
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|115456051|ref|NP_001051626.1|| Os03g0805200 [Oryza sativa (japonica cultivar-group)]
Score 706
Evalue 0
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig5483
GCGATAAAACAGTAGAGAGCAGAAAGGATCCAATCACTATTGCTAGTAAAGAAGCAGAAGCGCAACAATGACCACCGACCAACCCACCCAACAATAAACA
TCATCCAAAAACTACAGCAGCAGCAACAGGAAATTAGCCCACCCGGACTTTGATGCCAGTCAGAAAATAACCAGTACACGGGAAACACAAGTGCGGTGAC
AACCAGGCACAAAATAAGGTAAATGGGGGCAAGGGCACCATACCCACACCACGGTGACTACAAACCCCAATATCTGTTTTCAGCTAAGTCAATAGAATAC
CATCCATCCATCGGTTTCATTTCAATTCTCAACATTACCAATCCATCAGTCCCACGAGCTAGACGCACCTCCACCATAACCTCCACCACCACCGTACCCG
CCACCACCACCACCGCCGTAACCGCCACCTCCTCCACCGCCACCGCCCCTCGTGTCGCGACGGAAGTCACGTCCACCAAATCGAGCACCACCGCCGCCTC
CTGACCTGCGGTTTCTGCCTCCTCCGCCGCCTCCGAATGAGGAACGGGCAGAATAGCGCTCCAGCCACTGAGGAACCTCCTGATTGGCTTCCTGCATCAG
TTCACATAACGGCCTGGCCAGTGACATGTTGCCCTCATTGAAAAATGCAGTTGCCAGACCAGACTTCCCAGCTCTTCCAGTTCTTCCAATGCGGTGAACA
TAGTCATCAATGTCATTTGGCAGATCAAAATTGATGACGTGGGCGACATCTGGAATGTCAAGCCCACGAGCAGCAACGTCAGTTGCAACCAGGATGGGAG
TTGCTCCACTCTTGAAGGATCTCAGCGCATACTCCCTTTCCTGTTGTGTACGATCTCCATGAATACTTGTTGCAGGGAACCCATTTGTATACAGCCAGTT
CTCCAGAGCATCAGCGCCCCTCTTTGTCTCCACGAAGACCAAAGTAAGAGAATTCTTTCCAGGAACATCATTAGCCTTCTGCGCATGAATAAGGTCCATG
AGGTAACTTCTTTTATCCGCTTCAAGGACAAACTCCACCCTTTGAGCAATCAAATCGGTACTTGAACCAACTCTTCCAACAGCAAGGAAGATGTAGTCTG
CAAGGAAATCTGATGCCAGGCGTTGTATCTCCTTCGGAAAAGTAGCACTGAACAGCATGGTCTGTCTCACACCACGAGGGGGCATGTCCATCTGCTCAAC
AATCTTGCGTATCTGTGGCTCAAACCCCATATCAAGCATCCGGTCAGCTTCATCAAGAGCCAAGTAATTCACCATTTGCAGTGATACTCTAGCTCTCTCC
AGCAGATCCATCAAACGACCAGGAGTTGCCACTAGTATATCAACACCTCTTTCCAGTTCTCTCAACTGCTGATGAATTGGTGCTCCACCATATGCAACAC
AAGCCTTAACACCAGTCTGGTATGCAAATTTCTTTGCTTCTTCATGAATTTGGACTGATAGCTCGCGAGTAGGAGATAATATCAGAGCAAGAGGAAATGC
AGTCCTAGCTC
page-top