Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig1399  (registered. 2003)
Contig Information
Length 437 bp
Clones 2 Clones [Download: TSV  ,  FASTA ]
Wh_GCPCDAM Anther at meiosis of DT4B CS wheat 2
Homology (BLAST) Top Hit unknown [Zea mays]
Score 106
Evalue 0.00151835
Total Hit Count 11
Registered year 2003
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig1399
TGCTGGTTGAGGGTCTGATAATGGACGTAAGACAGCTGTTGGAGAGGAGATTAAAATATGGAAGATAGCAGCAGACGAGGTAGTTGAAGCTGGTAGATCA
ATTGAGCAAGAGCCCCAGATCCAGGGGTGTTTGTAATGAGCTGTTTGTAAGACCAGTGCTACATGGTTCCACTTGGAGTCTCTGTAGTTATTTGGCTGAT
GGTGTGTATGAGTTTGAGCTATTTATTATTGTGTAGTTTTGACTTTAGAACCATGGAAGCTGTCCCTCTTTTATAAATAACTTCATGTGGAAAAGTATTC
TTTCGAGGGAAACAAGGTCAAGAATTGGCATTAGTGGTTGGCGGTGATGATAAGTTCGCATTTTATACCAGCTAGCAAGACTTCAGAGAAATTTGTTAGA
GGAATTGCAATATATTTATCAAACATTANAAAAAAAA
page-top