Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig1398  (registered. 2003)
Contig Information
Length 459 bp
Clones 2 Clones [Download: TSV  ,  FASTA ]
Wh_GCPCDAM Anther at meiosis of DT4B CS wheat 2
Homology (BLAST) Top Hit membrane protein [Zea mays]
Score 275
Evalue 3.84929e-23
Total Hit Count 107
Registered year 2003
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig1398
CCTCGTGCCGCCGAGCCCGAACTAAGCCCCGGCTGCAGCAGCTCCCATTCCTCGCCGTCGAGCTCACCGGACACCGCCCGAAGCCAAGATGACTACTTCC
AGGCGCCTTGCTGACAGGAAGACAGCGAAGTTCCAGAAGAACATCACCAAGAGGGGTTCGGTGCCTGAAACCACTGTGAAGAAGGGGAATGACTATCCTG
TCGGACCTATAGTGCTTGGATTCTTCATCTTTGTGGTCATCGGATCATGTATGCATTCCAATCTCCTCTCAATCTCTTATGTTCAATCTACTTTACTGCC
ACTTGTCACATGCTCACTTTAGCATTTGTCATCAGCCACTTTGCTTTGGGAAGATATTTACCTAGTGACTACGTTTCTTTAATCTTAGCGTTTGTCATGA
GTATAATTGCATTAACATTTTGATTATTCATGTCCTATGTAAAGAGTGTAAAAAAAAAA
page-top