Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig548  (registered. 2012)
Contig Information
Length 1169 bp
Clones alternative view 14 Clones [Download: TSV  ,  FASTA ]
Wh_dL Crown of seedling 1
Wh_oh Pistil at heading date 1
Wh_V4816 Shoot grown under cold condition for 16days 1
WH_XJ Roots, two-week old seedlings treated with 150-mM NaCl for 6h (22 16L-8D) 1
WH_XL Roots, two-week old seedlings treated with 150-mM NaCl for 24h (22 16L-8D) 1
WH_XM Shoots, two-week old seedlings treated with 150-mM NaCl for 24h (22 16L-8D) 1
WH_XN Leaves, plant was grown at constant 23 1
WH_XO Leaves, seedling were infercted with blast strain Pr48 for 4 days (23 ) 2
WH_XA Root 2
WH_XC Root, treated at 50 microM Al for 6h 1
WH_XW Leaves, seedling were infercted with blast strain Pr48 for 4 days (23 ) 2
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|225593669|gb|ACN96318.1|| Di19 family protein [Triticum aestivum]
Score 431
Evalue 6.00E-119
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig548
TGCATTGCATTCTATAGTATGTAACAGCTGTGTGACGTTGGTACAGACCAATGTTCCTTGACAATGAAGAGGATGGCACAACAAGTTACAACCAAGGCAA
GGAACTGCTGGCCGATAATTCGGTGGAAAAAACGGGCAATATGGGACAGCTACCATAAATTAAGGTGTAATGTGTCAAGCCCAAATAAAATCCGCACTTG
ACTGCGGGTGCACCAGACGCACTTGACTTCGCCCAAGTTAAGATTAACCAACTCAGGGCGGAGTGCTGCAGTTCTATCCGAATCAGCGTGAAGGAAGCAC
CCATCTAACAAGGAAAATGCAGGGCCATTCAAGCACTCAGTCGTCTCCAAATAAAGTGGAGAGGACCAGGTCTTGCACAAAGGTCGCCCTGCTTGTGGCT
TGTTTCCGCTTTTGTTCCCTTTCCTCACTTGTGAGGGACGAGTCAATACTTGATTCCCAAGGTTGAGGAGGTGCCTCCTTAAGAATTGAAGTATCATCGA
GAACCGGAACTGATGATTTCGATGGTTCTTCGGCATCTGATGTTGCAAAACCCAGGCCAAACGATGAAAGCAGTGGATCAGCATAAATATTTGTAGTGGC
GGCGGTGGTGTTCCTTGACCTATGACTATGACCGCGTCCTAGAAGCGCCTTGAACAAGTAACCATGATGCATGGTGATATGATTTAGCATATCTCTTGTA
ATCTTTTCAGAGCAGATGGGGCAAGGCGCGGGGTGTGGCTCGTAGGGGTGGTCCTCCTCGAGGTGGACGCAGAGGGAGCCGAGGTCGTAGTCCTCGTAGC
AGTAGGGGCAGGCGACCTCCGGCCATCTTGCCTCCTCCATCTGCATCTCCATCTCCATGTCCATCTCCCCGTCGTCCTCCATGTCCATGTCCACTTCCTC
CATCCCCATCCCCGACATATCGTCGATGTGGCCGAGCTGCGCGGCATAGAAGCGCTTGGCGGCGGCGAGGCGCGAGATCCAGTGCTCCGAGTCCATGATT
GGATTGGGTTCCTCTTCCTCCTCTTGGTTCCTGTGCTAGACGCGCTTACTCAATCAGCCGCTTCCTCCGGGCCTCGCCTCCGCAGCCACCAGCTAGACCT
CTCGCTCCGACTACGACTCCGTCTCCGTCCGCCGCCGAACTCCGACAGCGAGAACCCAACAAGTGAACC
page-top