Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig5455  (registered. 2012)
Contig Information
Length 885 bp
Clones alternative view 19 Clones [Download: TSV  ,  FASTA ]
Wh_RDr Root of dessiccated seed 1
Wh_SHDr Shoot grown with dessication 8
Wh_VWD Shoot grown with dessication 1
WH_XO Leaves, seedling were infercted with blast strain Pr48 for 4 days (23℃ ) 1
WH_XC Root, treated at 50 microM Al for 6h 2
WH_XD Root, treated at 50 microM Al for 6h 1
WH_XE Seedling, infected with leaf rust 2
WH_XH Seedling, infected with powdery mildew (AvrPm3b) 2
WH_XX Leaves, seedling were infercted with blast strain Pr58 for 4 days (23℃ ) 1
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|226531366|ref|NP_001149126.1|| aldehyde dehydrogenase family 7 member A1 [Zea mays]
Score 360
Evalue 2.00E-97
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig5455
CGACCGGTCTGATCTAAGGTAACATGCGGAAAATGTTGCTTTCACTAGAGGAGATGCTACCTTTCCAGTTTATTAATAGACTAGGGCACAGATGGCTAAA
CATGTCAAAAAGGAATGAACAATGCATACATGAGAATCAACACATCTCTTATTATATGTACTCAGCAGCAGCGTCGCAATTTGGGTACAATGATCGACAC
ATAGAGAATTTCCTGAAGATGATGGCTGCACTCTGCAGATATCTCAACACGGCAACACCTTATCCCCAAGATGCAGCACGACGTTTCACTGGCAGTCCTT
CAGCACCAAACTAGCCAAAGTTTATTCCCTGTGCTAGAGGCAGCTCGCTTCCATAGTTGATTGTACAAGTGGCCCTCCTCATGTACTGCTTCCAGGAATC
ACTTCCCGCTTCTCGTCCACCACCGGTTGCTTTTTCTCCACCAAAAGCTCCACCAATTTCAGCACCATTAGTGGGTATATTTACGTTCACTATACCACAA
TCACTACCATGAGGCCCGATCCACTTGAAAATAGCATCTGGTTTCCTTGTAAATATAGAACTGCTCAGTCCTTGAGGAACAGAATTGTTGATTTCAATTG
CTTCCTTCAGGGTCTGAAATTTCATGGCATAAAGGACAGGACCAAACAATTCTTCCCTCACAACTGGCGCAGAAGGTGAAATTTCCACAATTGTTGGTTG
AACAAAGTTCCCTTCTGATTCAATAGCAGATCCTCCTAGAAGGATTTTTCCTCCCTGGGATCTGATATTTTGGATGCCTTTCAAAAAGCTTTCTTTAGAT
GCAGTAGTGTGCAGTGGTCCCAGCAAGGTGCCCTTTTCCANNNNNTCCCCGATACGGACTTGTTTGTAAACCTCAACAAGTTGAT
page-top