Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig5453  (registered. 2012)
Contig Information
Length 780 bp
Clones alternative view 5 Clones [Download: TSV  ,  FASTA ]
Wh_yd Spikelet at late flowering 2
Wh_EMI Dormant seed with water absorption after breaking 1
Wh_SHDr Shoot grown with dessication 1
Wh_V4816 Shoot grown under cold condition for 16days 1
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|115443987|ref|NP_001045773.1|| Os02g0128800 [Oryza sativa (japonica cultivar-group)]
Score 309
Evalue 2.00E-82
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig5453
GGCTGCGCCTACCAGGAACAGCATGCCAGGCTAAGATGCACTGGATTTGTATGACAAATTGCAAGAAATTTCACAACATACGTCGTACGTTCTTGGGAAC
CCTTTCCCTTCCACCAAGCATTTGTACACCAAGTAGCAGCAGAAGTAGCAGACAGTCTCCCGGCACGGCAACAAAACAATGGAATCACGGAGAGAACAAA
CGGCCGAAGAGGCATGTGCACAGACAGACAGGCTGGAGCCACGATTGCCGATCTAGTGCTCTTGCTGCAGCGGCGCGTTCCGGAGGAGAGGTAGGCCGCG
TGCCCCCAGCAGGAGCCGTCGGTCACTGCTCCTTCCAGATGCGGCCAGTCACGCGCAGCTTGAGCTCCTGCCGGGTGCCACTGGAGAAGAAGAGGGCCAT
GTTGCGGTGGATGATGAGCCCGTCGAAGCTGTCCCGCACCTTCTTGTGCCCGTCCCGGATGCTCCGCGGCGTGCCCTGCCACGTCAGCTTCCGCCCGTTC
CCGCCCACCTCCAGGCTGTAGCAGAAGCTCCGAGCCTCGCTCTCCTCCCCCATGAACCGCAGGAACGCCATGTACACCGGGGACATCCCCAGCAGGAACG
CCTCGAAGTGGAGGCAGAAGTGCTGCCCGAAACACTTGAAAACAGTGAGCATCCATGTTGCGTTTTCCACTTCGTAAGGGTTGGACTTCACATAGCGGTG
GTTAAAGGTGCAGCCTTCGTGCAAATCCACCTTGTGGTCATTGATGAGATGAGACACGAGCATCGGAACGTCACCTGCAA
page-top