Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig1037  (registered. 2003)
Contig Information
Length 577 bp
Clones 2 Clones [Download: TSV  ,  FASTA ]
Wh_HGCPCDAM Anther at meiosis of MT4B CS wheat 2
Homology (BLAST) Top Hit Os02g0697700 [Oryza sativa (japonica cultivar-group)] >gi|41052953|dbj|BAD07863.1| unknown protein [Oryza sativa Japonica Group] >gi|113537353|dbj|BAF09736.1| Os02g0697700 [Oryza sativa (japonica cultivar-group)] >gi|125540776|gb|EAY87171.1| hypothetical protein OsI_08572 [Oryza sativa Indica Group] >gi|125583348|gb|EAZ24279.1| hypothetical protein OsJ_007762 [Oryza sativa (japonica cultivar-group)] >gi|215767691|dbj|BAG99919.1| unnamed protein product [Oryza sativa Japonica Group]
Score 488
Evalue 1.28227e-47
Total Hit Count 56
Registered year 2003
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig1037
GGAGACTGGGGAGTCTGACCCGGCAGCCGATCCTGGAGATAGCCCTCACGGCATTGAGGTCGGCATCGAGTTCAAGCCGGTGGAGCACCCTGTGGAGCCT
GTCAACCTTGACCAACCAGTGAAATGCCCGCTTCCTGAGCCATCTATACTGCATGATGGAAGGATATGGCAAGAGAGGATGTCTACAGCGGGCGGGAGGC
CGAGGACAGACCTGCCGGTCGTGAAGGAAGGGTCGCAGCTCGAGCCCGACAGCAGCACCACAAGGTCGAGGTCTGCGGTCCGGAGGCGCGCCATACTGCC
CTCCGTGAGCGCCCCTGAGCATAACATCCTGGCGCTGCTTGACGAGTGCGACGTGCCTGAGAGCCAGCGTCCTGCTGAATGAGCCTGGATACCGTCTCGA
CTGTATCTGTACATTGCTGTATCTTCAATCACCGCCGTCGCTACGAGCTGAATACAGCCGTGTTAAACTCCGGTTGCAACTATAGCAACATGCTTTTGTG
TGGGTTGTTTCTATATATATGTACACACTTTATATACGAGTGAAAAGAAATCTGCAGGTGCATCGTCAAAAAAAAAA
page-top