Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig1021  (registered. 2003)
Contig Information
Length 623 bp
Clones 2 Clones [Download: TSV  ,  FASTA ]
Wh_HGCPCDAM Anther at meiosis of MT4B CS wheat 2
Homology (BLAST) Top Hit Os11g0156200 [Oryza sativa (japonica cultivar-group)] >gi|62701876|gb|AAX92949.1| At2g24280/F27D4.19 [Oryza sativa (japonica cultivar-group)] >gi|77548743|gb|ABA91540.1| Serine carboxypeptidase S28 family protein, expressed [Oryza sativa (japonica cultivar-group)] >gi|113644497|dbj|BAF27638.1| Os11g0156200 [Oryza sativa (japonica cultivar-group)]
Score 583
Evalue 1.46983e-58
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig1021
GACTTCGATATGGAGCGAAACATCATCGTCCTCCTATCCCTTCTTCTCTGCCTCCTCCTCTCGTGCCATGTATCCGCAGTCGGCGCCTCCGCCAAGCGGC
GGCACTCGTCGCCGCTGTCGCGTCCCCATCGTGTGATCACAGCGGAGACGGCGCCGGCCACGACGGTGCCGGCGATGGTGCAGTACGAAACGCGGTACCA
CACACAGCGGCTGGACCACTTCAACGCGGCGCCGGCGAGCTACCGCACGTTCCCGCAGCGCTACCTGGTGAACGGCACGTACTGGGGCGGCAAGACGGCG
CCGGTGTTCGTGTATGCCGGTAACGAGGGCAACATCGAGCTCTTCACCAACAACACCGGCTTCATGTGGGAGCTCGCGCCACGCTTCCGCGCCATGCTCG
TCTTCATCGAGCATCGGTACTACGGGCGATCGGTACCGTTCGGGAGCGAGGAGGCAGCATTCAGGAACACGAGCACGGCGGGGTACCTGACGACGACGCA
GGCTGTCGCCGACTTCGCCACGCTCGTGCAAAGCCTCAAGGCCAACCTCANCGCACCGACCGCCCCCGTCGTCGTCTTTGGCGGCTCCTACGGNGGNATG
CTGGNANCGTGGATGANGATGAA
page-top