Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig5433  (registered. 2012)
Contig Information
Length 1107 bp
Clones alternative view 10 Clones [Download: TSV  ,  FASTA ]
Wh_oh Pistil at heading date 2
Wh_SH - 1
Wh_EMI Dormant seed with water absorption after breaking 1
Wh_SHC Shoot grown with cold treatment 2
Wh_V4816 Shoot grown under cold condition for 16days 2
WH_XU Roots, 18 day old plants were grown hydroponically (supplemented with 10 mM Boric Acid for 24 h) 2
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|115457532|ref|NP_001052366.1|| Os04g0281900 [Oryza sativa (japonica cultivar-group)]
Score 353
Evalue 2.00E-95
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig5433
TTTTTTTTTTAAAAAGGTTAGAACATCTTATATCTTATACGTATTTGTGAACGGAAAGGGTATTGATTTTGCTTTGCTTCAAGCACCTTACAAGCAACTG
AACTCCTTAAATGAGGAAGCTCATCGTAGTTACATAGATCACCTGGGTGCCTGCAACGGAACTAGGTTCTCATTTTTGGAACGCATCAATGAATCCACCA
CAGCCTCACAGCAGAAGATTCAAAGCTAGTACAGTGTATATAGAATCAAGTAAAAAGAAGAGAGGCAGATGCACTATATGTAGCTTGAAATTAACTATGA
GCCCTTGCAGATTATTTCGTTCGCCTACACACACAGCGATACTACTACGTACGTACGTGTTTTGAGTTTTGACCCGTCATCGAGTAGCCAAGCCACAGCA
GCTAGGGATCCTCTCGGCTCAGCGCGGGAAGGCAGCGATCTCGACGCCCTTGTTGCCGAGCGAGGGCATGGGTGCGTCGTAGGCGCTGAAGAGGCGGTAG
GACGAGATGAGGGAGAGGAGGATGTAGCACACGACGGAGCCGAAGGTGATGGCCACCGACGTCCGGGCCTGCCTGCAGAAGCCGCCGAACACGCCGCACG
CCTCGCTCCACGTCACCTCCTTGTCGCCGTTGTACGCCAGGTAGAGCAGCTCTGCCGACGCCGCGCCGGCCGCCAGGATCAGGTACGTGAACACCTGGTC
TAGGAGGAAGACGATCCAGGAGCGGGACAGCGTCGCCGGCCGCGGCACGGCAGTGTAGAACGCGGAGACCAGGGAGTAGGCCGCGCACAGCCCGTTGGCA
TAAACCAGGTACTTGAATCCGCCGAGGTCGGAGTAGGAGACGGTGCCGTACTCGTTGGTCTGCGTGTCGCGGAGCATGACGGCCATGGCGGCGACGCAGA
GCCCCAGAGGCGCGGCGCGCAGCAGCGTCTCCAACGGACGGACCCGCGCCTCCGCGGCTGACAGGTCCCCTGCGATCAGCCCGTCCTCCCCTCCGCCGGT
CGCCGGCGCCGAGATCACCTTCTCGTCCGCCATCTTCGACATCTCAACCAGCAGTCAGGGGCCAAGNNNTCAACTTCCTCTCACTCCCGGTCCCGGTCCC
TCTCCTC
page-top