Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig888  (registered. 2003)
Contig Information
Length 1005 bp
Clones 2 Clones [Download: TSV  ,  FASTA ]
Wh_SHDr Shoot grown with dessication 1
Wh_VABA Shoot with ABA treatment 1
Homology (BLAST) Top Hit putative SMR family transporter, possible pecM-like protein [Synechococcus sp. WH 5701] >gi|87282523|gb|EAQ74482.1| putative SMR family transporter, possible pecM-like protein [Synechococcus sp. WH 5701]
Score 80
Evalue 7.76437
Total Hit Count 1
Registered year 2003
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig888
AAAGAATACTGGAGCTTGGGAAGATGAAAACTAAAAGATGGACAAAGTCGTTGTAAAATCTAATAATAATATAAGAACTGAACATAACTTGGTCGATATA
TGCTTGCCCACTAAACATAATTTGAACCATANAGAGACATGTAAAAAATAAACTAAGTGCATATTAGTTGCTAGATTGTTTATATACAACCTAGATTGAA
GTTTTCCGGCCCTGTATTGCGAAATGCCTTTCCCTTCAGAATTTAAATTCGTTCACAAAGTTCTATGTCTTGCTCCCACTCAACTCCCTTCCTAGCAATC
ACCATGTCCATTTCCCCACACCTAAGTGCCACCTGAAATACAAGAAGATAAAGTATGATGACGATCTTTCTCATGCTTGGCTACTTCTCTGTCTCATCCT
CATCTGTGCGCTTGCAATAGCTTCCTTTTTATGTATGCATTTCTTCCTAGTCCAGTGAATAGTTGCGAGCTCTTGTTGTTTCCTACAAGAATTGCTTACA
TGTGAAGGGCACGCCTTAAATCAAGGAGGACATGTGACAATCGCAACATCCCTGCAACCCACACTCATTAATGTGAATAGTTGTGCAATTGAATTTGTTC
TGGGCTTCACATCAACCAATGTCTCGGCAGGGGTGAAGGGAATGGGAAAAGTTTAATGTAAACGAAACACAACTCAGAATGAAAAAGCAACAACCACCCC
ATGAATCTAGCTTTGAATTCACCTTATTAGCGCTATCACTTTGCCATTTCTGTTTATAGGGCTCAAGAAGTTTTAAGACCAGGGATACTCTGCTCCAGAA
CATCTCAAGTATATGTATATACAAGAACTACATCATGCTATATTATTGTTCCCTAAAAAGAATAAGGAATAAAGTAGTAAAAAAGCTAAGCTTAGATTCA
TGGCTCCAACTTTATCCAGAACATCTCAAGTATATGTATATACAAGAACTACATGCCCATCATATGNGGTACTATATAGAAAAAATGACCTTCAGTCCTC
AAGTA
page-top