Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig885  (registered. 2003)
Contig Information
Length 941 bp
Clones 2 Clones [Download: TSV  ,  FASTA ]
Wh_V4816 Shoot grown under cold condition for 16days 2
Homology (BLAST) Top Hit unknown [Picea sitchensis]
Score 159
Evalue 3.82832e-18
Total Hit Count 91
Registered year 2003
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig885
ATCTGATTAGTTATGTCGTTTGTGTACGCGCTACTGTGTTACTGTCAGATGATCCAGTTAAGTTTCTTTTTTTTTTGAACTGATCCAGTTCAATTTTATC
ATTTGCATTGCATGGTGATCAGTGCAACTGTTGGACCCAAGCTTTATTACACGTCGCAGTAACCTATTGTTTTTATTACCAAGACAACTGATGTAGAGAT
GAGTTGGTGAGCAGTGACTTGTTAGGACGGATCAAGGTCGACTTCAACTCTGTCTGGTACTCTAGAATTGCCAACTTCTTTCAGTTTTATCACACGAATC
GGGTGCGCTATGTGTGCTTCCTATACAGGACGAGGACATATGTTATAGGCTTCGTGAATCATTATGATTCTACCTCTGCAAACTGAAATCATGTTGATGT
TGCAATTGTATGGCTTCCTTTTCAGGGCTATGCTTTGTTATGTGTTGGTTACCCATCCTCTGATCTTGAAGTTGAAACGCAAGATGAAGATGAGGCAAGC
AATTCTCTTAAGACGCCTAATGAATTTCTAGTTCAAATATGCTATAGGAACTAGTATGAAATATTCTTCTGAATTCCGATGATTGCGCGTCTATCTCAAT
TTGTAGGTATATTGGCTCCAGTTTGGAAGATACTTTGCGCGGGGGCCTGTTGACAGAGATGATTACGCGCTAGAGCTTGCAATGGGAGACGAGTGAAACG
TGACTGACAGCGGTACGGTTTTTAAGCTGCGGTTTGTAGGTTATATAGAGTTGCAAAAAAGACTTGATTTGCAAGTGGAGAAAGAAGAGAAAACAAAAAG
ACCCCTCTGCTCAATGCTCTCTGTGTTTTTGCAAATTTGCTGTGCAAATATGCTTCTTGCAGAGATGCCATCCTTTTTGCTCCTCTGTATTCACAGTAGA
CGAAGAACGCTATGGACTGTATGTATGTAAAAAGCTGGAAC
page-top