Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig5431  (registered. 2012)
Contig Information
Length 753 bp
Clones alternative view 2 Clones [Download: TSV  ,  FASTA ]
Wh_SHC Shoot grown with cold treatment 1
WH_XT Roots, 18 day old plants were grown hydroponically 1
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|242050802|ref|XP_002463145.1|| hypothetical protein SORBIDRAFT_02g038470 [Sorghum bicolor]
Score 290
Evalue 8.00E-77
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig5431
CAGAAGCATACAGCATCGATCGACCATGCTGCGCGAGAACACCATGGCCTCCCTTGTCTTCCTCGTGGCGCTGCTGCTCTCATGCAGCTCCATGAGCAGC
GCAGCACGGTACCTAGAAGAGGCCGTGCCCAAGAAGGAGTATCCACCACATCTGATCGTCCCGGAGCTGCCAAAGCCCGAGCTCCCGCCGCACCCTGTCG
TGCCCGAGCTGCCGAAGCCTGAACCACCTCACCCTCTCGTGCCTGAAGTGCCACACCCCGTGGTGCCGAAGTCGCCAAAGGAGCCTGAAGTGCCACACCC
CGTGGTGCCGGAGGTGCCAAAGCATGAGCTGCCGCCACACCCTGCTATGCCCGAGCTCCCGAAGCCCGAACTACCGCATCCGGCTGTGCCCGAGGTGCCA
AAGGAACCCGAAGTGCCACACCCCGTCGTACCGGAGGTGCCAAAGGAACACGAACTGCCGCACCCCGTCGTGCCGGAGGTGCCAAAGGAACCAGAAGTGC
CACACCCCGTCGTGCCAGAGGTGACAAAGGAACCTAAAGTGCCACACCCTGTCGTGCCGGAGGTACCAAAGGAGCACGAGTTGCCGCACCCTGCCATGCC
AGAGTTGCCGAAGCCTGAAATGCCACACCATGCCGTGCCAGAGGTGCCAAAGGAGCCCCATGTGTTGCACCCTGANNTGCCGAAAGAGCCCGAGTTACCG
CACCCTGCTGTGCCNNNNNNCCCGAAGCACGAAATGCCACCGTTCCCCAAAGC
page-top