Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig820  (registered. 2003)
Contig Information
Length 443 bp
Clones 2 Clones [Download: TSV  ,  FASTA ]
Wh_GCPCDAM Anther at meiosis of DT4B CS wheat 2
Homology (BLAST) Top Hit P0660F12.2 [Oryza sativa Japonica Group] >gi|15290155|dbj|BAB63845.1| P0660F12.9 [Oryza sativa Japonica Group]
Score 82
Evalue 0.913321
Total Hit Count 3
Registered year 2003
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig820
CTCACGAGTGCTTGCACCAACCGGATGAGCTATCAGCTTTATGATACCCCCGGATATATACACATTCTTTCCAGAGCCGTGGGCCGGCTTGGATTACATT
TCTTGAGTAGGCATAATTGGAGATCTAGCTGCAATTGCATTTGATGGGGACAGGCACCTGAGAGAGATAAATGGTGCCATTTGTTAGGTGATAATATACA
CAGATTGGCATGATTTGCCAGTTCTTTTGTTGTTGTCGGAAAAATAAGCAGCATGTGATTTTGTGTTGTACATATGATAGGAGTTAGAAGAAAATTACAC
CCACGAGTAGAGTTTTTTCTGTTTCTGAATTGTGCTTGCATGTGATGTGATGCATATACATACATTGTGACCGGTGCTTGTCAGAAGTTCTTCCATTGTA
ATACACAGTTTGGATGATTTGGTTGAGCTGATGAAAAAAAAAA
page-top