Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig803  (registered. 2003)
Contig Information
Length 716 bp
Clones 2 Clones [Download: TSV  ,  FASTA ]
Wh_GCPCDAM Anther at meiosis of DT4B CS wheat 2
Homology (BLAST) Top Hit Os06g0211300 [Oryza sativa (japonica cultivar-group)] >gi|51090511|dbj|BAD35713.1| sterol carrier protein 2-like [Oryza sativa Japonica Group] >gi|51091903|dbj|BAD35172.1| sterol carrier protein 2-like [Oryza sativa Japonica Group] >gi|113595159|dbj|BAF19033.1| Os06g0211300 [Oryza sativa (japonica cultivar-group)] >gi|125554513|gb|EAZ00119.1| hypothetical protein OsI_22123 [Oryza sativa Indica Group] >gi|125596462|gb|EAZ36242.1| hypothetical protein OsJ_019725 [Oryza sativa (japonica cultivar-group)]
Score 191
Evalue 4.91116e-30
Total Hit Count 216
Registered year 2003
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig803
GCCTGCCCCCTCCCCCAGTCCCCAAATCCGTAGTCCCGCGCGCCGCGATGGAGGCGAGCAAGCTCAAGGCGGCCAGGCTCCTGGAGCAGATGAGCGCCCA
CCTCGCCACCGACGCCGGCAAGGAGATCGCCAACAAGGTCGGCTTCGTCTACCAGCTCAACATCTCGCCCAAGGTATGTATGATATCCTCCTATCCCTCT
GTTTCCCCCATGGAATCCGCCTAAAGCTTGGTGCCCTCGGCCTCGGGGGTTCGATCTGATAACAGAAGATGGGCGTGGACGAGGAGATCTTCGTCGTGGA
CCTCAAGAAGGGCGCCGTCTCCACAGGTCCCAGGTCCCCCCGCCGCTCGATTCGTCCCGCGCGGGTTCTGAATTTCGGTTTCTTGGGCCGTGTTTCCTGA
AGAAATTCTTCCTCTGCTGTGGTCTCGGCGTGCAGGGAAGTACGAGGGGACGCCGGACGCGGCCTTCACCTTCACCGACGACGACTTCCTCGCCATCGCC
AGCGGCAAGCTGAACCCGCAGATGGCGTTTATAAGGGGCAAGCTGAAGATCAAGGGGAGCATCAGCGCCGCGCAGAAGTTCACGCCGGACATCTTCCCCA
AGCCGTCCAAGTTGTAGAACGCCGGGTTGCCGTGCCTTGCCCCAGTGATCGGTTAATAAAAGAGTCAGTTATGCTCGCGATGGCAATTTGGTGTGACCAG
AGTGTAAGAGAGTTTG
page-top