Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig5419  (registered. 2012)
Contig Information
Length 970 bp
Clones alternative view 115 Clones [Download: TSV  ,  FASTA ]
Wh_SL Seed DPA30 5
Wh_dL Crown of seedling 6
Wh_e Seed DPA10 5
Wh_f Spike at flowering date 2
Wh_h Spike at heading date 3
Wh_oh Pistil at heading date 5
Wh_r Root 1
Wh_yd Spikelet at late flowering 5
Wh_CSEC Callus 1
Wh_DPA20 Seed DPA20 9
Wh_EM Dormant seed with water absorption 3
Wh_EMI Dormant seed with water absorption after breaking 2
Wh_HGCPCDAM Anther at meiosis of MT4B CS wheat 2
Wh_KMP Shoot grown under continuous light 2
Wh_MS Seed DPA5 of DT3DL CS wheat 8
Wh_OKCS Seed DPA5 6
Wh_PCDAM Anther at meiosis 2
Wh_SHC Shoot grown with cold treatment 5
Wh_SHDr Shoot grown with dessication 1
Wh_V4816 Shoot grown under cold condition for 16days 1
Wh_VSCB Liquid cultured tissue 1
WH_XI Two-week old seedlingsi22Ž 16L-8Dj 2
WH_XJ Roots, two-week old seedlings treated with 150-mM NaCl for 6h (22Ž 16L-8D) 3
WH_XL Roots, two-week old seedlings treated with 150-mM NaCl for 24h (22Ž 16L-8D) 3
WH_XT Roots, 18 day old plants were grown hydroponically 3
WH_SP 3
WH_XA Root 4
WH_XC Root, treated at 50 microM Al for 6h 10
WH_XD Root, treated at 50 microM Al for 6h 3
WH_XE Seedling, infected with leaf rust 3
WH_XG Seedling, infected with powdery mildew (AvrPm3b) 6
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|399414|sp|Q03033.1|EF1A_WHEAT|EF1A_WHEAT RecName: Full=Elongation factor 1-alpha; Short=EF-1-alpha
Score 468
Evalue 6.00E-130
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig5419
TATGATAGCAGAGTACTAGCAAATGGGAAAGCAGGTTCTAGTACTAGCATTCACCACAGGAAAACAAAACCACAAATGGGATAAGAGCACAATAATGGAA
TCGAAATAGAGTATTTAAACGACACATCATAGCTCGCACACAGGTGCAGGAGTCAAAGTGCAATAACGCCCAGGAACACTTAACATACACTAAGATTCTC
CAAAAAAGACTTGACACTAAAACTTCTGCTAGATAACTCGATGGCAGACACCAGAGCACTCATTTCTTCTTGATGGCGGCCTTGGTAACCTTGGCACCGG
TGGGGTCCTTCTTCTCCACGCCCTTGATGACACCAACAGCAACCGTTTGTCTCATGTCACGCACAGCGAAGCGGCCAAGAGGAGGGTAGGTGGCGAAGGT
CTCCACAACCATGGGCTTGGTGGGAATCATCTTCACGATACCAGCGTCACCGTTCTTCAGGAACTTGGGCAGCGCCTCCAGCTCCTTACCAGATCGCCTG
TCGATCTTGGTCACCAGCTCGGCGAACTTGACAGCAATGTGGGAGGTGTGGCAGTCCAACACTGGGGCGTAGCCGTTGCCGATCTGACCAGGGTGGTTCA
TGATGATGACCTGGGAGGTGAAGTTGGCCGCTTCCTTGGCAGGGTCATCCTTGGAGTTGGATGCAACAAAGCCACGCTTCAGATCCTTCACAGCAACGTT
CTTGACGTTGAAGCCGACGTTGTCACCAGGAAGCGCCTCCAGGAGAGACTCGTGGTGCATCTCAACAGACTTGACCTCAGTTGTCAGACCAGTGGGACCA
AAGGTAACAACCATACCAGGCTTGATGACACCAGTCTCAACACGGCCAACAGGCACAGTTCCAATGCCACCAATCTTGTAAACGTCCTGAAGGGGAAGAC
GCAGGGGCTTGTCTGAGGGCCTCTTGGGCTCGTTGATNNNGTCAAGAGCCTCAAGAAGGGTAGGGCCCTT
page-top