Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig498  (registered. 2003)
Contig Information
Length 525 bp
Clones 2 Clones [Download: TSV  ,  FASTA ]
Wh_HGCPCDAM Anther at meiosis of MT4B CS wheat 1
Wh_VABA Shoot with ABA treatment 1
Homology (BLAST) Top Hit hypothetical protein OsI_14877 [Oryza sativa Indica Group] (no hit)
Score 104
Evalue 0.0167321
Total Hit Count 0
Registered year 2003
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig498
ACTCTCTCCCTCACACCCCCTTCTCCACCTCCGGCCGCCGCCTTGGCCAGGCCGGCGATGGCGGCGCGCCACCAGCACCTCCCACCACATCACCACCTTG
CGCCATCCACCAGTGCCACCATCTTCTTCTCCTTCCCCGAATCCACCATCATCCATCCACACCGCGTTACCAGCACCACAGCGCTTCCCCACACCTCGCG
CCCCTGCTGCTCTTCTTCTCCTATGCCTTGTTGCTGCTCCTTCTTCCCTCGCCTTGCTGCTGCTCCTCCACTTCTCAACTCGAACCAGCTACTCCTCCTC
CTTCCCTTGCCTCTTCCCAACTGCTGCTGCTCCTCCCCTCGTCCCTTTTGCTGCTGCTCTTCTCTAATCTTCATGCCGCTGCTCCCTTGCCTATCTCCCT
CTGCTGCTCGTTGCTTCCCCCTTCTCTAAACCCATGAACCTTGTTGCTGCACTTCTCTGAATCTGAATCTTGTTGCTCTCTCTCTCTCTCTCTCTCTCTC
TCTCTCTCTCTCTCTCTCTCTNTCT
page-top