Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig433  (registered. 2003)
Contig Information
Length 576 bp
Clones 1 Clones [Download: TSV  ,  FASTA ]
Wh_VHS Shoot with heat shock treatment 1
Homology (BLAST) Top Hit cinnamyl alcohol dehydrogenase [Lolium perenne]
Score 247
Evalue 5.95511e-40
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig433
AAGGGCACGCCCTGCGCTCGGTTGGGCCGCGAGAGACGAGTCCGGTCTCCTCTCCCCTTACAGCTTCTCGCGAAGGTCTTCCTCTATCCAGTCCCTATCA
TGGCGCGTACTCTGCTTGGTGATACTATGTGACTCACCTCTGCCTCTTGCGCTGCGCTGATGAATTCCTACAGGGTCCAGAAGGACGACGATGTGACNAT
CAAGGTGCTCTTCTGCGGGATCTGCCACACTGACCTCCACATCGCCAAGAACGAGTGGGGCAACGCCCTCTACCCCATCGTTCCAGGGTGGGTACACCAA
CCAAAACATATCATCGATGGTCTACGACTACAATGGTGGATTAACTGTTACCGTATTGCCGGCGCAGGCATGAGATCGTTGGCGTCGTCACCGACGTCGG
CCCTGGCGTCNAGAGCTTCAAGGTCGGGGACACGGTGGGCGTGGGCTACTTCNTCGACTCCTGCCGCTCGTGCGACACCTGCAGCAAGGGGTACGAGAAC
TACTGCTCCACCCTCGTGCTCACCTCCAACGGCGTGGACTACGACGGAGCTACCACCCAGGGGGGTTTCTCCGACG
page-top