Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig413  (registered. 2003)
Contig Information
Length 785 bp
Clones 1 Clones [Download: TSV  ,  FASTA ]
Wh_HGCPCDAM Anther at meiosis of MT4B CS wheat 1
Homology (BLAST) Top Hit hypothetical protein OsI_27812 [Oryza sativa Indica Group]
Score 282
Evalue 1.91695e-23
Total Hit Count 25
Registered year 2003
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig413
GAAGAAAAGGAAGCCTCGCTTTTCCTGGAATATACACTTGCCCGTCAATGGGGGCCTACAAACCTGGAGTTCATCTGCAGATCTACAACCTTAAGAGAAT
GGGTGAAAATAATGGCAGAAGACACATTTTTACAGTGCAACAATACTTTGTTAACCACTTAATTTAATGGGTACATAGTAGTATTGCTCGGAACTGTCAG
CACGACTTCTGGATGAGTCACAAACCTACTTCTATGTTCTGGGATGCCGGCCAAGCAACCGGCCTTGTACTGGGAGCAGAGAGCACTGCCATTCTGGTTG
GCCTTCCGCCTGAAGAAGCTCGCCGTCGACACCACAACCACTGTGGGTACTGCCCACTGGCCTAACCTTTACTTGTTTTACCTGCAAGAAATGGTCGCAA
AATCGAGTGTCAAAGATCGACAAAGGTAATTATTACTCAGCTCGGCAATCTACAAAGTGAGGCCGTAGAGTGAGTGGAGTCATGAGATGCAATTAATTTT
AAGAACACAAAAACTAGCTCTAGGTCCAGATTCAAGATGCCTGTCTGAAACAGCCATTACAAGCCAAGTGAAAGAGGTGGTTAGATTTAATTGGGGGAGA
ATGATACAAAAGTTTCAATACCTTGACATATTCCACAAAAGGGAGTAGAAGATGCCAGCAAAACTGATAGGCAACAAAAAAGCAAAATAATCTGAGTCTT
CCACTTCCATGTACAAGAATCAAGTCCAGACTGCCATCATCATGCTGAGCTTTTGGTGCAACAAGTGGAGAAAATAACCCCTGGG
page-top