Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig5382  (registered. 2012)
Contig Information
Length 1183 bp
Clones alternative view 56 Clones [Download: TSV  ,  FASTA ]
Wh_dL Crown of seedling 1
Wh_e Seed DPA10 1
Wh_h Spike at heading date 2
Wh_CSEC Callus 1
Wh_EM Dormant seed with water absorption 1
Wh_EMI Dormant seed with water absorption after breaking 1
Wh_KMP Shoot grown under continuous light 2
Wh_KMV Shoot grown with continuous light after cold treatment 6
Wh_OKCS Seed DPA5 1
Wh_RDr Root of dessiccated seed 1
Wh_SHC Shoot grown with cold treatment 2
Wh_SHDr Shoot grown with dessication 3
Wh_V4816 Shoot grown under cold condition for 16days 6
Wh_V483 Shoot grown under cold condition for 3days 5
Wh_VABA Shoot with ABA treatment 1
Wh_VHS Shoot with heat shock treatment 3
Wh_VWD Shoot grown with dessication 5
WH_XI Two-week old seedlings(22℃ 16L-8D) 3
WH_XM Shoots, two-week old seedlings treated with 150-mM NaCl for 24h (22℃ 16L-8D) 1
WH_XT Roots, 18 day old plants were grown hydroponically 1
WH_XA Root 2
WH_XC Root, treated at 50 microM Al for 6h 2
WH_XD Root, treated at 50 microM Al for 6h 1
WH_XE Seedling, infected with leaf rust 1
WH_XF Seedling, infected with leaf rust 1
WH_XG Seedling, infected with powdery mildew (AvrPm3b) 2
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|55832255|gb|AAV65329.1|| putative glutamate decarboxylase [Hordeum vulgare]
Score 621
Evalue 6.00E-176
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig5382
TTTTTTTTTTCATCTTTTTTATCTGGAGCCGGGGAAAACCCCTTTATTAAAAAGAAACAGATAGAATTATACAAGTGACAGTGCAATCCGCGTGCGTACG
TACAAAATACGGAGGAGGCAGGTCTTGACAGTTCACATACGCACCCCTCCACAATAATTATACAAGAATCAAGATACAACATAGACAGACGTGTTAAAAC
AAAGCACGGCCATCAGCAGACTCCGGCCTTCTTGTTCCCGGCCAGGCCCTTGAAGGCCTCGGTGACGGCGTCCACGGTGCTCTTGGAGGCGCCCTCGGCG
GCGGCGGCGTTGGACAGCTTGATGGCGTGGACGGCGTGCGCGTCCAGCTCGCGCACGATCTTGTTGATGTCGGCGAGGAGCCGCTGCGCGAGGCTCCGGT
TGAAGTCCTCCCGGATGACGATGCGGAGGACCGCGACGTGCTCCGCGTCCGCGGGCATGGTGTAGGCCGGCACGATCCACCCGAACCTCCTCAGGTTCTC
CGAGATGTCAAACACGCTGAAGTTGGTGCTGTCCTTGAGCCTGATGGCCACCAGCGGCACGCCGTCCGCCTTGGAGAGCACGTCGAACCGCCCTGTCGCG
TCGATGCCCTCCTTGAGCACCGCCGCGTTCAGCTTGCAGTTCTCCATGATGTGCTTGTACCCCTCGAAGCCGAGGCGGATCAGTTGATAGTATTGTGCAA
TGATCTGGCTAGCACCTTTGGAGAAGTTCAGTGTGAATGTGGGCTGATCTGTTCCCAGATAGTTTATGTGGAAAATGAGTTCGTCGGGCAGATCGTCTTT
GCTCCGCCAGATGACCCATCCAACACCAGGGTACACAAGGCCATACTTGTGCCCACTAACGTTGATGCTCTTCACCAATGGCAGCCTGAAGTCCCATTCA
AGCTCCGGCTGAAGAAAAGGAGCGATAAATCCTCCACTGGCGGCATCGACATGGATCGGCACATTCCACCCTGTTTTCTTGTTCTTCTCCACAAGAAGGT
CATTCAACAGCTTCACATCTTCGTACTCTCCAGTGAGAGTAGAACCCAAGATGGCTGCAACACATATAGTGTTCTCATCCACCATTTCAATGGCCTTCTT
AGGATCCATGACATAGTACCCTTCAGTTAACTTGACCTCCTTCAGTTCCACCTCGAAATATCTAGCAAACTTCTCCCAGCAAA
page-top