Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig337  (registered. 2003)
Contig Information
Length 725 bp
Clones 1 Clones [Download: TSV  ,  FASTA ]
Wh_VSCB Liquid cultured tissue 1
Homology (BLAST) Top Hit hypothetical protein LOC100193290 [Zea mays] >gi|194692870|gb|ACF80519.1| unknown [Zea mays] >gi|195620992|gb|ACG32326.1| alpha-expansin 13 precursor [Zea mays]
Score 242
Evalue 7.14035e-19
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig337
GAAGCACACGGACGAAAAGCTGCTTGCTGGGAGCCATGGCTCCCCCGCTCCTCCTCCTCGTCCTCTTCCTCCTCCCGGCCCTCGCCGCCGGCCACCAGCA
CCCCTCCTCCTACGGCTCCTCCGCCCTCTCCGAATGGCGCAACGCCAAGTCCTCCTACTTCGCCGCCGACCCCGGAGACGCCATCGGTAGGCATCAACAA
ACCTCGCCTCCCTCTCCGCCCTCCCTCCGCCCGTCATGGCAGCAGTCCAAGAAACGAATCCACCAAACCGTCCTTGCGCTCTCGCCAAAATTCCCCGCGT
CCATGCCGCAGGCATTAATTAGTTCACTTTTCCTCTTTCGGTATGTTGCCGCCAACGGAATTTCCACAAACCGCACGCTCGGTTACCGGAGCTTCTCTGC
TCGTACCACAGTCGGTTCTTGCGATCCTGGCGGCCATGGACATGGGTACGGAGCTGATCTGTGCTTTTCTTTTTGTGGGGTGCGGCGTGCAGGTGGCGCG
TGCGGGTTCGGGGATCTGGGGAAGCACGGGTACGGGATGGCGACGGTGGGGCTGAGCACGGCGCTGTTCGAGCGCGGNGCCGCCTGCGGNGGNTGCTACN
ANGTCAAGTGCGTGGAGGANNTCAAGTANTGNCTCCNCGGNANNTCNATNNTNNNNANGGNNANNAANTTNTGNNNNNNNAANTANNGNTTNNNNNNNNA
NNNNNGNNGNNNNNGNANNNNNNNN
page-top