Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig98  (registered. 2003)
Contig Information
Length 859 bp
Clones 1 Clones [Download: TSV  ,  FASTA ]
Wh_OKCS Seed DPA5 1
Homology (BLAST) Top Hit Os07g0531600 [Oryza sativa (japonica cultivar-group)] >gi|27261043|dbj|BAC45159.1| putative 1-acyl-sn-glycerol-3-phosphate acyltransferase [Oryza sativa Japonica Group] >gi|113611389|dbj|BAF21767.1| Os07g0531600 [Oryza sativa (japonica cultivar-group)] >gi|125600524|gb|EAZ40100.1| hypothetical protein OsJ_023583 [Oryza sativa (japonica cultivar-group)] >gi|218199750|gb|EEC82177.1| hypothetical protein OsI_26293 [Oryza sativa Indica Group]
Score 791
Evalue 2.15148e-82
Total Hit Count 323
Registered year 2003
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig98
AACAATAATCACATGNATTAAGGATATAAGAATGATCAGGACTGACTGTCCACATGAAACAGAGGTCAAATACCAATACAGCATCTACTGATAAGAACAC
CAATGCTTACGTGTTAACACTAACCAATCATAAGATATTAAAAGATCTATAGGCACGCATCCATTCAATAGCGGAACCACTATGCGTACAATGCTTCATG
GTTCAATTTGTGTACCACGCAAAATCTGATGTCCACTGCAGTTTTGTTCAGCGCATCAACGGCTTGATCTAATGCGTCGTACACAAATCGGACAAGCAGT
GTCGTATGTATAGCAAGGTTGATTCAATAGTTCTTTCTTGCCAAGCACATGCTACTGATTCTGTCAAACAGGAGAGCCTGAGTTGATTGATAGCTATTTA
GTTTTCCTCTAGTCTCCTCAGCACAGATTCAGCAAACATGCGCTGCTTTTCCTCGGTATGTTTGGGGCTAGGGCGGTTATGTTTCAGATAGCCATCCCAT
GGAACCTTCTTAAGACCAGCCCGAGCAGCTATCATATCCCTCACTCTTTCAGTAAATTCTATCGCTGTCTCCCCTTCCCTGAGATACTGAGGTTCCAAGA
ACCAAACATCACAAACAACAGCCCATGATGTCATAAGACGAACCAAATGCATTGTAAAAGATTGCTTCTTACTATTCCAGAAGGCGTCAACAAATATTTT
ATTATATTTGATAGCTATTGGACATACAGCACAGCCAAGCTCAAAAGCACCCTTCTTGAACATCACAGTGTACTGATTATTAACACAAGTTCCTTCTGGG
AAAATCAAGAGAGGATTGTTGTCTGGATGCTGAACATGATCACGTAACTTTCTTCCAAC
page-top