Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig97  (registered. 2003)
Contig Information
Length 773 bp
Clones 1 Clones [Download: TSV  ,  FASTA ]
Wh_VABA Shoot with ABA treatment 1
Homology (BLAST) Top Hit hypothetical protein OsJ_017556 [Oryza sativa (japonica cultivar-group)]
Score 847
Evalue 5.66808e-89
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig97
ATTTCTCTCTCGCAGGCCCGACGCGACGCGACCCCCTCCCCTCCCTAATCATTGATTGATTGCCCCTCGCTCGACCGGGCCGAGGTTTCTCCCGCCGGCG
AGGAGCGGGCCCGCTCGCGCGCAGACAGAATCCGGTCTGAAGGGCGGTTTTGCTCGGCTCCGGCTCGGTGTGTTTGGTGGATCGAGGGGATGGAGCGGCG
GCGGTGGCTGCAGGCCGCGGTTCTAATGTGCTTGCTGCTGCTTTGCTCCGGGAGAGAACTTAAGAACAAAAGACAAGCGCCAGCATATAATTCCACTCTC
GCCAAGACGCTTGCAGAGTATACTTCAGCAGTTTATACTAATGACCTGTCACAGTTATTCACCTGGACCTGTGAAAAATGTGGTGACTTAACGGAGGGGT
TCGAGGTGATCGAGCTGATTATTGATGTGAAAAATTGCTTGGAGGCATATGTCGGTTTTGCAAGTGACATGAATGCTGTTGTAGTTGCATTCAGAGGGAC
TCAGGAGAACAGCATCCAGAATTGGATTGAGGACTTATTTTGGAAACAACTTGATTTTGACTATCCAGGCATGACTGAAGCAAAGGTGCACAGTGGGTTT
TATTCTGCATATCATAATACAACATTGCGTGATGGAGTCATCAATGGCATCCAGAAGACCAGGGAAGCATATGGCAATATTCCCATCATGGTGACAGGAC
ATTCCATGGGAGGGGCCATGGCTTCGTTTTGTGCCCTTGATCTAATTGTTAACTATGGGGTTAAAGGACGTGA
page-top