Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig95  (registered. 2003)
Contig Information
Length 659 bp
Clones 1 Clones [Download: TSV  ,  FASTA ]
Wh_DPA20 Seed DPA20 1
Homology (BLAST) Top Hit caleosin 1 [Hordeum vulgare] >gi|34538475|gb|AAQ74238.1| caleosin 1 [Hordeum vulgare]
Score 833
Evalue 1.71152e-87
Total Hit Count 128
Registered year 2003
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig95
CGGCAGTTATCTTCTCCACGATTCCGCTCACGGTTCATCGGTTGCCACCCGGTTCTGGTGCGCCGTCGCAGAGCGGCGGAGATGGCCACCAAGGGGCGCA
AGGTCGTCGAGGTCCGTGGCGCGAACAAGACGGATGGGCATGGCGACGCGGGCAGCATGGTCGGGGACATCCGGGGCATCGACGGGAAGGACTCCCTGAA
GATCGTCGCGATGCAGGCGCCGGTCACCGTGGAGCGCCCCGTCCGCGGCGACCTCGAGGAGCACATCCCCAAGCCCTACTTGGCGAGGGCTCTGGCGGCG
CCGGACATGTACCACCCGGAGGGGACGACGGATGATCACCAGCACCACAACATGAGCGTGCTGCAGCAGCACGTCGCCTTCTTCGACCGCGACAACAACG
GCATCATCTATCCCTGGGAGACTTACGATGGGTGCCGTGCGGTTGGGTTCAACGTGTTCACGTCCGCCTTCATCNCGTTTCTGGTGAACCTGGTCATGAN
CTATCCCACCCTGCCCGGCTGGCTGCCNAACCCCCTCTTCCCNATCTACNTGCACAACATCCACAANANCAANCACGGNANTGACTCNNGGACCTACNAC
AANGANGGCCNNTTCATGCCNNTNAACTTCNANAACATCTTCANCAANTACNCCCNCAC
page-top