Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig91  (registered. 2003)
Contig Information
Length 805 bp
Clones 1 Clones [Download: TSV  ,  FASTA ]
Wh_VSCB Liquid cultured tissue 1
Homology (BLAST) Top Hit hypothetical protein CHLREDRAFT_151407 [Chlamydomonas reinhardtii] >gi|158273915|gb|EDO99701.1| predicted protein [Chlamydomonas reinhardtii]
Score 78
Evalue 8.9583
Total Hit Count 1
Registered year 2003
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig91
GATAAGCTACCCCTCAAAAAAAAGTGACACAATAAAATGTACTTAATACATGATGAACATTTCTTAGAAATAGTGGTCAAATACATCATATAATTTGGTT
CTGTACAAAAAAAAGTTTCCTCTTTTGTGTACATATCCTAAACACCACCCCTTGCGATGAACTGTGTCTTTGTCCACAAATTTGGTTATTCCCCATCCAG
CATGTCAGTTGCAGTCTCCTGAGAAGGCCGTTCTTCAAGCTGACTCCTAGCAGAAGATGATGCATCTAAGTGAAGCTACCTGGAGATTTCTTATATGTCC
CTTGCTCTCTACTGCAACAGATAGTTGGAATGGCATATAAGGTAAGTGTGAGGTACTGACAGAAGCTCACTCTCAAAAGGCACATTCAGTATGTGTATGT
AATGATATAGATGCGTTATTAATTAAGTAACCTGAATAAGTAGTTGCATATTTCTTCTAGGGACAACTGTTTACATATTTCTTCTATATCCATTGCTCTC
TGATGTTATAGCATATATCTGTACTGTAAGTAACAAAAGAGTAGTCTCTTTCCTTTTTTCAACATAACAGTCTACTTATCTGATGCACTTGGGCTAACAG
GAACATAAGAAAACACCAATGACTAATCATTTGGAAGGCAGCATGGCTGAGTCCTACACATGGCTAGTCAAGCCCTCTTGCCAAGCTGGAAAGTTTCTTA
CAAATGCGGAAATATCCATAAGATTGCATCTCTCCTGTTCTACTCAAATAATATTTTGTATATATCAGAGGTTTCAAAAGCTAGGTACCAGTTAACTCCC
TATTG
page-top