Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig90  (registered. 2003)
Contig Information
Length 661 bp
Clones 1 Clones [Download: TSV  ,  FASTA ]
Wh_GCPCDAM Anther at meiosis of DT4B CS wheat 1
Homology (BLAST) Top Hit unknown [Zea mays]
Score 722
Evalue 1.27224e-74
Total Hit Count 58
Registered year 2003
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig90
ATCCTTCATTTGGCGGTGCTGCCTCCAACTCTGGACCTGTGTCTAATGCTGGCGGTCGGTCAAACTACTCCGGTTCTCTTTCATCTTCAGTTCCTGGCGC
TGGAGGATCAGCAAGAGCAAAATCTAATTCCGGACCACTCAATAAGCATGGAGAACCAGTAAAGCGGTCATCTGGTCCCCAGTCTGGAGGTGTGACCCCA
ATGGCTCGCCAGAATTCCGGCCCTCTCCCTCCAATGCTTCCTACGACTGGGCTTATCACATCTGGCCCTGTTACTTCTGGACCACTGAATTCGTCCGGTG
CCCCAAGAAGGAAAGTATCTGGGTCTCTGGATCCTGCTGCATCGATGAAGGCGCGGGCCACATCGCTTGCTCACAACCAGGCTGTTACTACACTCACCAG
TGAAGATGGTTTCTCAGTTATGGGAAGCATTTCAAAGAGAGGCGTGCTCAGGTTTGTCAATAGCTGTCCTGATACTGATCTCAGAACTGCAAAGGATGGA
GAGTATGTGAAGGTTACAGGGGTTGTTACGTGTGGAAATTTCCCCCTGGAGTCCTCATTTCAAAGGATTCCAAGATGTGTGTACACTTCAACTAGGCTGT
ATGAGTATAGGGGCTGGGATTCAAAAACTGCAAACCCCAAGCATCGCCGGTTTACCTGGGG
page-top