Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig87  (registered. 2003)
Contig Information
Length 716 bp
Clones 1 Clones [Download: TSV  ,  FASTA ]
Wh_EM Dormant seed with water absorption 1
Homology (BLAST) Top Hit hCG2042085 [Homo sapiens]
Score 80
Evalue 4.23335
Total Hit Count 4
Registered year 2003
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig87
TGGATCTCAAGATCAACATCAGGTGCGTTCATCCGACCACAAAAGACGGCCATTCAACACGAAGTTCGATACCAAAAGCGAGAATACATAAGGAGAGCCA
ACTACGAAGCCATAATCACTAAGCATACTAACAAGTGGCGTAATTCATCTGCCTTGTCGATGTACTTCACAAGGACCGCCTCACATGGAACCTTGATACG
CATTGGAGCAGCTGTGAATTAGGAGAGGCGCCATCTAATAGAGCGACCTTTTTTCCAAATGTCCTTCCAAGCGGCTGCTTGTGTCTTCCATTGTGTCAGG
AAGATCTCCAACAGAGTAGTCCATGGCAACCACATTTCTAATGTGCACAGGAAAGTAATGCATGTATCTGACGGCAAGAAGCCAACCTCTAGCAAGCATC
CTTTTATTGGTCCTTGACTCCTCTAACTGCTGCAGGAAGTGCTCGGCATGGCGCTGATGTCGTTTGGACGAAGCAAGGTTCAAGTCTCTAACAACCGTGT
TTGTCATGTCCTCTATGTATATGATAGCCTTTATCATAGCGGTATCCTCGGCAGCCTCATCGTCGGTGCAATAAAGCCCTGGCACAGAAATGTCGCTGAT
TGGTCCCCCAAGGTTAATTGTGGAGGTGTTGAAAGAGACGGTTACATGGATCTTGCCATCCTCATGAACAACACGCTCGTACTCGTCTAGAGATAACTCA
AGATGCGCTAGGAGGC
page-top