Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig86  (registered. 2003)
Contig Information
Length 880 bp
Clones 1 Clones [Download: TSV  ,  FASTA ]
Wh_PCDAM Anther at meiosis 1
Homology (BLAST) Top Hit vacuolar proton-ATPase D subunit [Triticum aestivum]
Score 1142
Evalue 4.43207e-123
Total Hit Count 231
Registered year 2003
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig86
GCCTAGCCCGGATATCAGAAGCAAGCTGAGCCCGGCACGACCTTTGGCTTGTGAAGGCGAATTCTTTTCTGGCTGATAGATAAAAATCCCCACCACATCC
GCAAGCGCGAACTCCCTCCCCGGATCTGCAACTAGCCGGCTTCCCTCCCGATCCGTCTCGCCGCGGCCGAGATCCTTCCTTCCTCCGGCGAGAGCCAAGA
TGTACTCGTGGGAGATGCTGTCGTTCAACATCCACGACGGGTTCCTGGAGGCGATCGTGCGGGGGAACCGCTCGGGCCTCCTCACCCAAGCCGATTACAA
CAACCTCTGCCAGTGCGAGACCCTCGACGACATCAAGATGCACCTCTCCGCCACCGAGTACGGTCCATACCTCCAGAACGAACCTTCTCCCTTGCACACG
ACAACAATTGTGGAGAAGTGCACTCTCAAGCTGGTTGATGAATACAAACACATGTATGGACACATGATCGATAATGTTGTACTTATTGTTACTGGGACAT
TGCATGAAAGAGATGTTAACGAACTGTTGGAGAAATGCCATCCATTGGGCATGTTTGACAGCATTGCATCACTTGCGGTTGCTCAAAATATGCGTGAGCT
TTACAGGCTGGTTCTAGTTGATACACCCTTAGCACCGTACTTCTCAGAGTGCATTACATCTGAGGATCTGGATGACATGAATATTGAGATCATGAGGAAC
ACACTCTACAAAGCGTATCTTGAGGATTTTTACAAATTTTGCGCGAAACTAGGTGGTGCGACGGCTGAGATTATGTGTAATCTCCTTTCATTTGAAGCCG
ACAGAAGAGCTGTAAACATTACAATAAACAGTATTGGTACTGAGCTGACTAGAGATGACCGCCGGGAAGCTGTACTCCAA
page-top