Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig82  (registered. 2003)
Contig Information
Length 720 bp
Clones 1 Clones [Download: TSV  ,  FASTA ]
Wh_RDr Root of dessiccated seed 1
Homology (BLAST) Top Hit Os05g0144400 [Oryza sativa (japonica cultivar-group)] >gi|75288644|sp|Q60EX6|BSL1_ORYSJ RecName: Full=Serine/threonine protein phosphatase BSL1 homolog; AltName: Full=BSU1-like protein 1 homolog >gi|53749344|gb|AAU90203.1| putative Serine/threonine protein phosphatase BSL1 [Oryza sativa (japonica cultivar-group)] >gi|113578176|dbj|BAF16539.1| Os05g0144400 [Oryza sativa (japonica cultivar-group)] >gi|215767692|dbj|BAG99920.1| unnamed protein product [Oryza sativa Japonica Group]
Score 505
Evalue 2.23438e-49
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig82
ACACTTCAGTTACAACATCACGAGGAGGTAGTTTTCCTCCAGCCAATCTAACTCAGTAAAACTTGTATAGCTGCGCTGTGCAAGCAGCGTCCTAAATGGT
AACGAACACGGTATACGGAACACATTACAAGCCTTCTCTCTGGATGAACAATGATCTAAACATGTACAACACTACAGTTACAGGTAAACCGCGACAATGA
TACACACAGACTCCCACTTTCCAACAATTATCTGACAACATTCCATTCTTCCCTTCAGAACTGTTATGTATGTAGCTCCCCAATGAGGGGCTGACTGCAC
TTGCAACTGGCGAAGAAATTTCTGACGAGAAACATACAGGGTCAAGATGGAGGGGGTCGGCTATGTATCATATGTAAGCAAGAGAGTTCCTGTCACCAGC
AGAATGCGGCCGTCCTCTAGTTGGTGTAGGTGGCCGCTTTATGTTAAGTTCCTGCATCCATGTGGCATCCATGGCACGTTCAGGGGATGACTCAGGAGAA
TTAACAGGTGGTGGAAGTGGATGAATTAACTTCGGGACAATAACTAGTCCCCTTCCCACCACAAGTATGGCGCCAGCATTATTTGCAGTGCCACAATAAT
TAGTGGCTGAAAATAAAGTGATCAACTGCCCATGGGCGAAACGCTCAAATCCATCCATAACACACTCATGAGCTCTTATGATCAATTGCAATTTGTTTCG
TTTACAGAATTCTGCCACTC
page-top