Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig81  (registered. 2003)
Contig Information
Length 508 bp
Clones 1 Clones [Download: TSV  ,  FASTA ]
Wh_DPA20 Seed DPA20 1
Homology (BLAST) Top Hit cupin family protein [Zea mays]
Score 302
Evalue 3.23916e-26
Total Hit Count 39
Registered year 2003
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig81
CACGTACTAGAACACAACACACACTAGCGACACAAACACGGAAACAGACGGCGCAAACACGCGCATGATGTACAGAAGTTTCGACCAGAAGAACACATGT
AAGATCGATCATCTGCTAAATAAAGCATTAAGCAGATGGCTAGCCGCGTGCGCTCACTCCCTCGCCACTTGCTTCATAACAAACGGTTCCCTCTCCTTCC
GCCCCTTCTCCTTCTCCGGCAACGGCGGCTCGATCACCGCCCAACCCGGCCGCGAGCTCCGGCCCGAGCATCATGCGGAGGACAGAGGTGGGGCCGGTCA
GGAACTGCGGCTTGTTCCGCCGCGCCGACGTGGTGAACCCGAAGAACACGAACGGCCCGCCCCGCGACGCCANCTGGACGAACGGGAGGTGGCGTGGGAT
CCAGAACACGTCGCCGGNACGCACCTCCGCGCTCATNGCAAGCGACCNGTTGGGGAAGANATCNTGGATGACGCCTTCCNCGGCGAGCANNANGCCNTAN
TCCGTTGC
page-top