Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig79  (registered. 2003)
Contig Information
Length 216 bp
Clones 1 Clones [Download: TSV  ,  FASTA ]
Wh_EMI Dormant seed with water absorption after breaking 1
Homology (BLAST) Top Hit hypothetical protein OsJ_013036 [Oryza sativa (japonica cultivar-group)] (no hit)
Score 305
Evalue 3.34266e-26
Total Hit Count 0
Registered year 2003
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig79
AANACTGAAACGACCCTGATAAACANAGTGTCCTTTTGGCAAGNTCATGCATTATTGCACCAGGTTTGAGGTCCATCAATCAAAACAAATCCCAAGCACA
TGAATTGAGCGAACACTTCAAACCACCCTCGCATGCTTTGGTTCGATAATCANCCACTGGCAGGCCCAAAGATTCTAAAAGGACATCCAGCACCATTCTG
TAGGGGATTTTCACCA
page-top