Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig77  (registered. 2003)
Contig Information
Length 788 bp
Clones 1 Clones [Download: TSV  ,  FASTA ]
Wh_CSEC Callus 1
Homology (BLAST) Top Hit aminotransferase y4uB [Zea mays]
Score 255
Evalue 2.61091e-20
Total Hit Count 437
Registered year 2003
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig77
ATGCGCCCGCGCCGGCACCCACGACCTTCGTGCCGCCGGCCAAGCCCGCACGCTGGTCCCCTCATGCCACTGCATCTCAAACCCCGGGCGTTCCTCCCTC
AGCCAGCATCAGCAGCAGCGCCGTCCGCGACAGAGGAGCATCCTCCGCCCACCACCCGCCGTTGAGGAGCAGCTGCGCCGTCCATTCTGAGGAGCCGCCC
GCCGTTCTTCTTCCTCCACCGGCGACACGTGTACCTCCAGATCTCAACAGGTTTAAGGGGCATGGCATGTTGGCACCATTCACAGCTGGATGGCAGAGCA
ATGGTGTGCATCTGTTGGTTATTGAGAGATCTAAGGGTTCTTATGTTTATGACATCAATGGGAACAAGTATCCAGATTCTCTAGCAGGACTGTGGTGTAC
AACTTTAGCCGCTGAATAAACCAAGGTAAAGAACGACAAGCACGGAAAAGGCTAGCTGTTGGCTGTGGGTTCTGAGCTGACGGACAATGTGGAAGAAGGT
GTGATCTTGGCAGTGGCCCATGAAGTACTTTTTTCTTTACATGTTGATCACTACTGCACTGTTCAAGTTCTTAATCAAGTGACTGATCGACTAGATTGTG
GGTCACAACCAAGGGAATGCTAACCGTGGTGGTGGTGGTGATTGAANAGCCCTTAATCAATTCGGCCTTATANATTGGAGCACCAACATGGGATATTGCA
CCATCTANCTCTGTCTATCTGATTCATCTTATTTTCTTGGTCTATCAACTANAGGAATCTACAAGTATGTGCTGCATGTTTTTCTGCT
page-top