Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig76  (registered. 2003)
Contig Information
Length 758 bp
Clones 1 Clones [Download: TSV  ,  FASTA ]
Wh_EMI Dormant seed with water absorption after breaking 1
Homology (BLAST) Top Hit hypothetical protein LOC100191317 [Zea mays] >gi|194688590|gb|ACF78379.1| unknown [Zea mays] >gi|195628616|gb|ACG36138.1| TGF-beta-inducible nuclear protein 1 [Zea mays]
Score 683
Evalue 1.19885e-86
Total Hit Count 188
Registered year 2003
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig76
GATCTTACACCAGGATAGTCAGTAAGGGAAGAAGACTGTTCCACCTTGACATTACACTAGATAGTGGGTCTATTCCAAAGACAAGCACGAACTGCAATAC
CGACAAAACTGCCCTTGTTAGACCGGATACAAACAGCGCACTCAGCACCTTAACCAGAATTGTATCAAAGCTTCACACGAGCAAGACAGCATTGATACAG
CCATCATTCTCCGGGTTATTTGTAACCTGCGCGTATTTGCCCCAAACAACTTTTCCAGCAGGGGTTACGAGACCGAGTTCACTAACGTTCACATTTCAGT
TCAGGGTGAGTCACATGAGCCTTGGTGAAACGCAGACCAGTAGGCCGGATGAACCTCTCATACTTTGGTGGCTTCCTTGTAAATCCAGGGCCAACAAAGG
TGGCTTTAGTTACCATTCTCTTCCACTGCTTGGTTTTCCGCTTGCCAGTGCGTAGAACTTTGAACATCTCTTCTTCAGCAACAGGTCTGACCTTAGGCAA
AGGAACATCCCATTTGCCAGCCTTTTCCTTCCTCTTTTGCTTAATTGTGTTGCTGAGAACCTTGGCGCGCTGTGTCGGATCACGATCCAGCAGATACGAA
GGAATGGCACCCTCCTCAACATCATCATCAACCTTCTGCCGGGAAGAAGACTCATCGTGCATTTTCAGGGTCTTCTTCATCTGCGCCTTCTCGGCATACC
GCTTCTTGGCGAACCTCTTGCCCTTGGCACCANGTAGCTTGCGGGCATCCTTGGAGTT
page-top