Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig75  (registered. 2003)
Contig Information
Length 752 bp
Clones 1 Clones [Download: TSV  ,  FASTA ]
Wh_VSCB Liquid cultured tissue 1
Homology (BLAST) Top Hit calcium-binding protein [Zea mays]
Score 394
Evalue 1.80618e-36
Total Hit Count 209
Registered year 2003
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig75
GGTCGCTTTCGTCTCTCTCTCTCTCAGCCCGCGCCCCCCTTTCGCCGACGCCGAAGATTCAACGCTCCCCCCGCCGCCGACGATTCGCCCGCCCGCCCGC
CCGCCCATGTCGATCCAGGGCCAGCTCCTCGAGGTCAGAGATGGGGGAAGGAACCCGTCCTTCGACGAGAAGTTTCATATACCACTCATCGAGGGGCTCC
GTGAGCTGAGTATCAACGTGTGGAACAGCAACACAATCAACACTGATGACTTCATTGGCAGCTGCAGGGTGCCACTGAACAAGGTGCTCACGAGTGGCTA
CGATGATTCCTCGTGGCCCCTCCAGACACGCCATATGAAGTCTGCTGGGGAAGTTAAGCTTATCATGCACTTTGATGTCTCAGCAATGAAGAACAAGATG
GCAGGTAAAACTTCTGGCCAGTACGCTCCTTCGCCATACGGTGCCTCCTCAGCTTCATACCCAGCGCCTTCAGCATATGCTGCAGCACCCCCACCGCACC
AAGCTTATCCAGCTCCTAGCCACGCACCATATCCTGCTCCTTCTGCGTACTCAACTCCGCCTCCTCAGCAGCCATACCCAACTCCGCCTCCTCAGCAGCC
ATACCCGCAGCAGGGAGGTCCTCCTACAAGTCACCCACCACAGCCATATGGACAACCGTATCCACCGCAGCCATACGGGCAACCGTACCCACCACAGCCA
TATGGGCAGCAACCTTACCCGCCACAGCCATATGGGCAACCATACCCACNAC
page-top