Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig73  (registered. 2003)
Contig Information
Length 731 bp
Clones 1 Clones [Download: TSV  ,  FASTA ]
Wh_DPA20 Seed DPA20 1
Homology (BLAST) Top Hit Os05g0463700 [Oryza sativa (japonica cultivar-group)] >gi|113579324|dbj|BAF17687.1| Os05g0463700 [Oryza sativa (japonica cultivar-group)]
Score 158
Evalue 3.99854e-09
Total Hit Count 22
Registered year 2003
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig73
CATCCATACAAGAATCATATGATGTCCCAGCAGATTCAACCGACGGGGCTGCTGACAACCCGACACTAAAATGTGCATACGAAAGAACATGGCTTTGCCT
ACCTGATTCAGGATGCTAATTAACCAGATGGAAAAGCCGCACCAACCGAAGTTCCGCAACAGCTCCGCTTTATGGTTACACCAATACCCTTGATACCGAC
AGAAACAAGAATTCGCCGTGAGCTAGCTAGCCTTTCTGTTCAGTTGCACCACCTGCCCATCAGCCGCCTATGCCATGGCGTCCTCCTCGGCTGTCATAGC
TTTCTCATCTGGCGCTTCGACCGTGGCACCCTCTGCGTTTTTCTTGGCTGTCGCAGCTTTCTCATCCCGCGCTTCGACCATGGCATCCTCCACTGGTTTC
TTGGCTGTTGTAGCCTTCTTACCTGGTGCTTCAGCCGTGGCACTCTCTACAGGTTTCTTGGCTGTTGTAGCCTTCTTACTTCGTGTTTTAACACCGACAC
CCTCTGCAGTTTTTCCAGTTGTTGTAATTTCAGCATCAGCTGCTTCGGCAGTCGTTTCACCTTGTGTGGACATACCAGCAAGTGCTTCAACAGCAACTCT
CTCATCTGGTGAATCGCCTGTGGCTTCACCTACACCAACCTCCCCACCCGGTGATTCAGCAGCATCCCTGTTTTCCATTTCATCCCCTGGTGCCTTCCCA
AGTGTCCCTGCAGTANCTTTATCTTCTACAG
page-top