Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig72  (registered. 2003)
Contig Information
Length 716 bp
Clones 1 Clones [Download: TSV  ,  FASTA ]
Wh_EMI Dormant seed with water absorption after breaking 1
Homology (BLAST) Top Hit unnamed protein product [Vitis vinifera]
Score 129
Evalue 8.80662e-06
Total Hit Count 28
Registered year 2003
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig72
ACACCACGTGACTGGACCGGGCAATATAGTTCTTACCCTTGGAGACTACACATACACATTGCTAAGATGTACACAACATAGGCAGAAATACCTCGACAAC
TTGAGAGCCCTGGGATTCATCCCGATGACACAGCAGCAGCCGTGGAGCACCGTTCGCTTCTGCACGTGCTCGTCCGCGCATGTCTCCACCACCGCCTTGC
GCCTGACGTTGTCACCGTAGAACAAGAACTTCTTTAGGTGTTCAGATTGCAATAGGTAGTCAGGTTCATCGTCATCATCCGAGTCCTGCCGTGGGATCCG
CAAGCTGCATCTTCTGTGTTGGTGCCATCATCATCAAAGAGAACTATCTGATCCTCACCCCAATATTGATAGCTATCCATTTTGTCAGTCAGCACACAGA
ACTTAATTCCTGCTTGTGGGAGCTTTTCAATGCATTCTAGTACCTTTTCTGGAGCTTGTCTTCAGCAGCAGTAGCACCAAAAGCAAGTCACACTCAATGT
TGTCAGCAACCTCATGTTTTTTCATCTTTGTCAGCATCTGTTGGCAGTGCTGAAGTATTCATTGAAGTTCTCACGACCTTTCTCATCCAAGACATGCTAT
ACAAGAAAAAATGTTCTTAGACCAGAATCACAATACACATTTTGTTGACTTCTAGTCTCTTCCCCAAATTATCTTCCAGAGCTATGTATCCNAGACATGA
GCTACTGAATTCCAAG
page-top