Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig71  (registered. 2003)
Contig Information
Length 583 bp
Clones 1 Clones [Download: TSV  ,  FASTA ]
Wh_DPA20 Seed DPA20 1
Homology (BLAST) Top Hit Os06g0665100 [Oryza sativa (japonica cultivar-group)] >gi|52076506|dbj|BAD45384.1| Dreg-2 like protein [Oryza sativa Japonica Group] >gi|113596343|dbj|BAF20217.1| Os06g0665100 [Oryza sativa (japonica cultivar-group)] >gi|125556388|gb|EAZ01994.1| hypothetical protein OsI_24026 [Oryza sativa Indica Group] >gi|125598147|gb|EAZ37927.1| hypothetical protein OsJ_021410 [Oryza sativa (japonica cultivar-group)] >gi|215715261|dbj|BAG95012.1| unnamed protein product [Oryza sativa Japonica Group] >gi|215765651|dbj|BAG87348.1| unnamed protein product [Oryza sativa Japonica Group]
Score 265
Evalue 9.35267e-22
Total Hit Count 420
Registered year 2003
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig71
TTCGTCGCACGGCTGAATCACTTGCCACATTCAGCAGTCACCACAGCACCGGAAGCCTACTACCAGAGTTCAAGTAGCTCCAGCTAGCTAAACTGGCCAG
TGAACCATCACTACAACACATCCCTTCTCCTTGGCTCCCTCACTCCCCAGCAAGAGCACAACAGGAACTATCCCAGGGGGCGAGATTCAGAGCTTCTCGG
CCATCCTGCGCAGCAGCGCGGCCCCTAGTGGCTCCTCGGTCGGGTTCTTGGTGAGCCATGCCTGCGCGGCCTCGAGGTCAGGGAGCAGCGCGTGCATCCC
GATGCTCCGTGCGGGGACGTAGTCCTTGCGGTAGCTGTCGCCGATGTGGAGCGCCTCTTCCGGTGCGACGTTCCCCGCCATCTCCAGCGCGATCTTGTAN
ATTTTTGGGTCAGGTTTCTCAACNNCGACNATGCCTGANAACACCNCNAANTNNNNNTNNNANNNNTGATTNNNNNNTANNNNNNGNNANATGANNTNTT
TGNANNNNNANTNTNNNTTNNTGANNATNNNNNNTGNNATNNNNTTNTNNNNNNNNNNNNNNNTNNNNNNNTNNNNNTNNNNA
page-top