Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig67  (registered. 2003)
Contig Information
Length 658 bp
Clones 1 Clones [Download: TSV  ,  FASTA ]
Wh_RDr Root of dessiccated seed 1
Homology (BLAST) Top Hit cinnamyl alcohol dehydrogenase [Lolium perenne]
Score 872
Evalue 5.08354e-92
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig67
TCCAGCTCGAAGTCTAGGCGAAGAAGCAGAGCAAGCAATCATCAATGGAGAAGGGCACGCCTGCGCTCGGTTGGGCCGCGAGAGACGAGTCCGGTCTCCT
CTCCCCTTACAGCTTCTCGCGAAGGGTCCAGAAGGACGACGATGTGACGATCAAGGTGCTCTTCTGCGGGATCTGCCACACTGACCTCCACATCGCCAAG
AACGAGTGGGGCAACGCCCTCTACCCCATCGTTCCAGGGCATGAGATCGTTGGCGTCGTCACCGACGTCGGCCCTGGCGTCGAGAGCTTCAAGGCCGGGG
ACACGGTGGGCGTGGGCTACTTCATCGACTCCTGCCGCTCGTGCGACACCTGCAGCAAGGGGTACGAGAACTACTGCTCCACCCTCGTGCTCACCTCCAA
CGGCGTGGACTACGACGGCGCTACCACCCAGGGGGGTTTCTCCGACGTGCTCGTCGTCAATCAGGACTACGTCCTCCGCGTCCCGGAGAGCCTGTCTCTC
GCCGGGGCGGCGCCGCTGCTCTGCGCCGGCGTCACGGTGTACAGCCCGATGATGCAGTACGGCCTCAACGCGCCGGGGAAGCACCTCGGCGTCGTCGGCC
TCGGGGGCCTCGGCCACATGGCCGTCAAGTTCGGCAAGGCGTTCAGGATGACCGTCAC
page-top