Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig64  (registered. 2003)
Contig Information
Length 805 bp
Clones 1 Clones [Download: TSV  ,  FASTA ]
Wh_VWD Shoot grown with dessication 1
Homology (BLAST) Top Hit Os08g0411200 [Oryza sativa (japonica cultivar-group)] >gi|113623755|dbj|BAF23700.1| Os08g0411200 [Oryza sativa (japonica cultivar-group)] >gi|215767987|dbj|BAH00216.1| unnamed protein product [Oryza sativa Japonica Group]
Score 713
Evalue 2.10376e-73
Total Hit Count 101
Registered year 2003
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig64
ATTTTTTACCTCCTCCTCTCCCACGCATCCGCGTCTGGACTCCACCATGGCGGCAGTTCGAAGCGCAGCCATCTCCGCTGCCGCAGTCGTTGCGCCGCGC
GGCTTTGGCAGGCGCCGTCGTCTTGTCCCCTGCTTCGCGGCGCCTGCACGAGGCGCATCAGGAGTCACCGCCTCCGCTTCCGGGAAGATGCTCCCGCGCT
CTGCCCTACATGCTAGCGCCTCCACCACTGGGGCGCCCGACTCAGACGAGGCCGCTGCGGAATCTTTGGTGGAGGCGGAGCTGAGCAAACTCGCCTGCCC
AATCTGCTATTACCCGCTCGTAAGCTCGATAGATCATCAGTCAGCGCCATCCAAATCCGATTCTACCCTTGAATGTTCTACCTGCAAGAAATTGTTCTCT
AAGGATGATTACTGGGATCTGACTGTGGCAGTTGGTTCTACTGAGTACTCCGAGACCATGCCTGCTGCAACTGAGCTTTTCAGGACCCAACTGGTATCAT
TTCTTTATGAGAGAGGATGGCGCCAAAATTTCATATGGGGTGGTTTCCCAGGCTTAGAGAAAGAGTTTGAGATGGCTAAGGATTATTTGAAGCCAAAAAG
TGGAGGGATTATAATTGATGCAAGCTGTGGAAGTGGGTTATTTTCAAGATTATTTGTTAAAAGCGAACTATATTGCCTTGTTGTGGCACTANATTTCTCA
NAGAATATGTTGAAGCAATGCAAGGAATTCATCAAGCANGAAAACATTTCANACGAACGCTTANTATTGGTGAGAGCTGATATATCTAGGCTTCCTTTTG
TGAGT
page-top