Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig61  (registered. 2003)
Contig Information
Length 870 bp
Clones 1 Clones [Download: TSV  ,  FASTA ]
Wh_V4816 Shoot grown under cold condition for 16days 1
Homology (BLAST) Top Hit ubiquitin fusion degradation protein 1 [Zea mays]
Score 711
Evalue 4.1006e-73
Total Hit Count 231
Registered year 2003
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig61
TGTTGAGAATGATTGTGCTACTTGACAAATAGATTGCCATCGAGCTAAACCGTTTATCACTTCATTTTCCTATCACACGCGGTTGGTGTGCTGATTCAGA
CGAATGCGAAGTGGAGATACAGAGTTCACTACAGCTACCACCATCTTGCTTGGAAGTTGTCACTGGCAATAAATACCAGCAGCAGCTAACGCTTCAAGGA
GTAGCTCTTTCCTGTGAACGCGTTGAACTTCGGCTCTTCCTTCTTCGGAGGCTCACTCCCTTTAGCAGGCTCCTTCTGTGCTTCTGCTTCTTTCTTGCTG
CTTGCACTTGAACCAAACACAAGCTTTCCTGTTTTCTGGCGCGTGGATGTGCTGGCTCCTGAAGGTGATGCAGTTTGCTGATTTGCCCTTTTGTTTGAGT
CTGAAGGCGCAGAACGTGCAGCCGCAGTGGCCGAAGAAGCTCCAGGTGCTGGTTGTTTTGGGCCCTTACCATCCAACCGTTTTCCTGAACCAGTGAATGG
TTTGAACTTTGGTTCATCTTCAACGATAGCCTCTTGATCTTCAGCAGGTGCCTTGCCTGCAGGAACTATGGGACGCTGTGGTTTTTCAGGTTCTTTGTAA
TCAAGAGGAGGTGCAAAGTCCACCTCACAGTCTGTCTCAATAATGCTAACTGCAGAAGCAGGTTTTGCTTCAACAATATCAATATAATACTGTTTGTTGT
TGTAAGCTACCATGATGCTGTCGCCCGTGGTTAAGCAAGAGAAGTTTCTTANAGTTTTCTCCAAGATGGCTTTGGGATTCNAGATGTCCAGGAAATCANT
CGTGTGAGGCTGCAGCTTCACATATGTACCCTTGGGAANAGTAACATTCTTGACACGTACAATGTCACCC
page-top