Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig58  (registered. 2003)
Contig Information
Length 806 bp
Clones 1 Clones [Download: TSV  ,  FASTA ]
Wh_OKCS Seed DPA5 1
Homology (BLAST) Top Hit hypothetical protein OsI_21448 [Oryza sativa Indica Group]
Score 218
Evalue 5.26656e-16
Total Hit Count 5
Registered year 2003
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig58
CACATCATGGTCATTCCATACTAGTTAATAACACTGGGGTTGCACTGCTATCCAAACCAACTCACTCTCACATAGCTGAAGGTTCATCAATCTATGATCA
CCAGAGACTGTTCCAGGCAGCGAACGCGATCTCGAAAAAAGAAGAAAAACTTTTAATAATCTACCGCGATATCACCATCAAACAAAGCGCTCAGAGTAGC
GAGACTTTAGTTGACAATGATGTCAGATGTTCCACGAGAAGCCACCGTCCCCCGGCTGCTCCCCCATGAACAGCCCGCTCTCCACAAGTTCGTGGGAGAT
GAGATGTTCCAGGTCGTCCATGTCATGCACAGACTCCGCCTTTGGGGTCGCCGCATTGCCGCCAGAAGCAGCCGGGTTGCTGCTCACTGACTTGAAACTG
CTGCTTCGCTGGACCATGCGAGCTCCACTGTTGATCAGATTACTAGGCCCCGTCATACCCATCAGAACAGCGCCCTTTGCTGCGCCGTTATTCATGTGCT
GTGCCTGCTCTCCGCTAGCAGCGATGTTGGCGACCGCGGCTCCAGATGCAAGACCACCATTTGCATTGGGAGTGCTAGGAGACTGCTGCTGCTGTTGATG
TTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGTTGATGGTGTTGCTGCTGCTGCTGTTGATGGTGCTGCTGCTGTTGTTGCTGATGAGCAAGAGCGCGG
CTATTGGTGTTCTTGGCTTCTTGCANCAGCTGATTGATCACATGCTGCTGGAATTGTGGACTANCGCCCANGCCCTTGGAAATTGTTATGCTGGTGTTGG
GGGCAT
page-top