Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig56  (registered. 2003)
Contig Information
Length 639 bp
Clones 1 Clones [Download: TSV  ,  FASTA ]
Wh_V4816 Shoot grown under cold condition for 16days 1
Homology (BLAST) Top Hit Na+,K+/H+ exchanger [Hordeum vulgare]
Score 894
Evalue 1.35437e-94
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig56
TGGATTTATCTCTTCTCTTCTATTTAAATATGCGGGATTGGATATTGACAATCTTCAGAACTTGGAGTGCTGCCTTTTTGTTCTCTTCCCATACTTCTCG
TATATGTTAGCAGAAGGACTTGGCTTGTCAGGAATTGTTTCTATACTATTCACAGGGATGGTTATGAAGCACTATACATACTCTAATCTGTCAGATAACT
CGCAGCGCTTTGTTTCGGCCTTCTTTCACTTGCTATCATCTTTGGCTGAAACATTTGTCTTCATTTATATGGGCTTTGATATTGCCATGGAAGAGCATAG
CTGGTCACACGTTGGGTTCATCATCTTCTCGATTATATTTATAATTGTTGCAAGGGCAGCAAATGTCTTTTCTTGTGCCTACTTGGTTAATATATCGCGG
CCAGAACATCGGCGTATACCTCTAAATCACCAGAAAGCTCTTTGTTTTAGTGGGCTTAGAGGAGCCATGGCTTTTGCGCTTGCTCTCCAATCTGTGCATG
AACTTCCTGAAGGACATGGAAAGACGATATTAACAGCTACCACAGCCATTGTCGTTTTAACGGTTCTTCTTATTGGAGGGTCGACAGGCACCATGTTAGA
AGCTTTGGATGTAATTGGTGATGAAAATACATCAATAGA
page-top