Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig55  (registered. 2003)
Contig Information
Length 813 bp
Clones 1 Clones [Download: TSV  ,  FASTA ]
Wh_OKCS Seed DPA5 1
Homology (BLAST) Top Hit hypothetical protein OsI_10891 [Oryza sativa Indica Group] (no hit)
Score 635
Evalue 2.11685e-64
Total Hit Count 0
Registered year 2003
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig55
CATACAAGTACGATTCAATAAAGATCCATTTATGTATCAACAATAATAAAGAACTATTACTATGAGAAAATGAAGTGTCTTTCACAGAAGTGATAAGATG
CCAGGTGAGAAAATCAAGTATCAACATTTATATATCTCCAGCCAATTGAAGATAATGTCATGCAAACCAAACCATGCCTTCGCACTTTACAACAAGAATT
CCTTGTCAATCTCCTCCGGGTCTTGTTGACGCCTTTGAGAATTGTAAGCACTCCACGGCAAACTCAAAGGAAATAATGGATTTACACAGGTTTAAAGTAG
GCTTTTCTGAAAACAAACTCAAAACTGAATTAGAGCACAATTTACAAAATTAAGGTAACTCGGAGAAAGATATGAAAAAATTCCTGAAATTCTCATAACA
TTTGTACTGTGAATGACAACAGAAAAAAGAATAGAAGATCTGAATAACAGTAATTGGAAGGATAGAACAACATTTGCTTTAAATAAAATTAGCTAGTTGA
GGCTGCAAGAACAACATAGAAGCAAGCATGGATCTAGCAAATGTTGGGCAAGCACACCTGACCAGCTACAGACCATTTAATCGTTAGTGCTAAAAGAGAT
ATAACTCAGAAACGCAGACCTACACGTTTCCTTGTGTTCTTGGCTATTTGTGTACCTGCCCTTTGTCCGGATGGTCTTCTTCATGTTGCACGGGCCACCA
CACTCGGAACTCGCTGACGCGTTTGCCATTAGCTGTTGATCCTCGGGAAAGCATGCCGCTTGGTGGCGAGGGCCTCAACATGGTGGCGGCGGTGGTCAAG
CAGAGGAGTGGAG
page-top